ID: 1117156841

View in Genome Browser
Species Human (GRCh38)
Location 14:52950688-52950710
Sequence GCTTTCGGCAGAAACTCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 46}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117156822_1117156841 26 Left 1117156822 14:52950639-52950661 CCGAATTCGCAGCGCCGGCCACG 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1117156841 14:52950688-52950710 GCTTTCGGCAGAAACTCGGGAGG 0: 1
1: 0
2: 0
3: 0
4: 46
1117156821_1117156841 29 Left 1117156821 14:52950636-52950658 CCACCGAATTCGCAGCGCCGGCC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1117156841 14:52950688-52950710 GCTTTCGGCAGAAACTCGGGAGG 0: 1
1: 0
2: 0
3: 0
4: 46
1117156831_1117156841 8 Left 1117156831 14:52950657-52950679 CCACGGGCTGGGAGGTGGTGGAG 0: 1
1: 0
2: 8
3: 72
4: 552
Right 1117156841 14:52950688-52950710 GCTTTCGGCAGAAACTCGGGAGG 0: 1
1: 0
2: 0
3: 0
4: 46
1117156820_1117156841 30 Left 1117156820 14:52950635-52950657 CCCACCGAATTCGCAGCGCCGGC 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1117156841 14:52950688-52950710 GCTTTCGGCAGAAACTCGGGAGG 0: 1
1: 0
2: 0
3: 0
4: 46
1117156829_1117156841 12 Left 1117156829 14:52950653-52950675 CCGGCCACGGGCTGGGAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 243
Right 1117156841 14:52950688-52950710 GCTTTCGGCAGAAACTCGGGAGG 0: 1
1: 0
2: 0
3: 0
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117156841 Original CRISPR GCTTTCGGCAGAAACTCGGG AGG Intronic
916091893 1:161314159-161314181 GATTTCGGCAGAAACGCCGCTGG - Intergenic
918515963 1:185363551-185363573 CCTTTGGGCAGAAACTATGGGGG - Intergenic
920038641 1:203082039-203082061 AGTTTCTGAAGAAACTCGGGGGG + Intergenic
921661916 1:217813195-217813217 GTTGTCTGCAGAAACTTGGGTGG + Intronic
922194564 1:223348836-223348858 GCTTTCAGCAGAATCTCAGATGG - Intronic
1066301562 10:34101801-34101823 GCTTTCAGTAGAGACTCTGGAGG - Intergenic
1070163980 10:73884107-73884129 GGCTACTGCAGAAACTCGGGAGG - Intergenic
1077043813 11:535702-535724 GCTTCCGGGAGCAACGCGGGAGG + Intronic
1077612067 11:3649433-3649455 GCATTGGGCAGAGACTAGGGAGG - Intronic
1089463020 11:118663797-118663819 GCTTATGGCAGAAACCTGGGAGG + Intronic
1091566303 12:1651000-1651022 GCTTTCAGCAGAATATCAGGAGG + Intergenic
1103852080 12:123939942-123939964 GCTTTCAGCCCACACTCGGGTGG + Intronic
1105303854 13:19155938-19155960 GCTTTCTGCACACACTTGGGAGG - Intergenic
1117156841 14:52950688-52950710 GCTTTCGGCAGAAACTCGGGAGG + Intronic
1118154770 14:63228876-63228898 GCTTCTGGAAGAAACTCGGAAGG - Intronic
1120228937 14:81821970-81821992 GCTTTAGGCAGAAAACAGGGAGG + Intergenic
1123027351 14:105432954-105432976 GCTTTCGACTGAAGCTCAGGCGG - Intronic
1128737620 15:70062107-70062129 GCTTCGGGCAGAAACTTGGCCGG - Intronic
1135501746 16:23001773-23001795 GCTTTCTGCAGCAACTTGGATGG - Intergenic
1139215323 16:65121385-65121407 GCTTTCGGCAGGGATCCGGGAGG + Intronic
1159075749 18:63679904-63679926 GTTTTTGTCAGGAACTCGGGGGG - Intronic
1165301980 19:34975933-34975955 GGTTTCAGCAGAAACACTGGTGG - Intergenic
929789218 2:45011321-45011343 GCTTTCTGCAGAAATCCAGGTGG + Intergenic
933422052 2:82061399-82061421 ACTTTCATCAGAAACTTGGGTGG + Intergenic
934995276 2:98952014-98952036 GGTTGCTGCAGAAACACGGGTGG + Intergenic
938292565 2:130157829-130157851 GCTTTCTGCACACACTTGGGAGG - Intronic
938463988 2:131515140-131515162 GCTTTCTGCACACACTTGGGAGG + Intergenic
939575847 2:143893619-143893641 GCTTTCACCAAAAACTAGGGCGG - Intergenic
944868169 2:203882495-203882517 GCATGCGCCAGCAACTCGGGAGG + Intergenic
946784667 2:223230343-223230365 TCTATCGGCAGCATCTCGGGTGG + Intergenic
1175241490 20:57552738-57552760 GCTTTTGGCAGAAAATTGGAAGG + Intergenic
1181685244 22:24523489-24523511 GCATTTGGCAGACACTGGGGAGG + Intronic
1183615201 22:38940178-38940200 GCTTTCTCCAGAATCTCAGGTGG + Intergenic
953038942 3:39237812-39237834 GCTCTCAGGAGAAACTCCGGAGG - Intergenic
979509692 4:121538202-121538224 GCTTTTGGCAGCAACTTGGATGG - Intergenic
1003306051 6:4930465-4930487 GCTTTCGGTGGAAAGGCGGGTGG + Intronic
1024905549 7:54374905-54374927 GCTTTAGACAGAAACGTGGGTGG - Intergenic
1033246085 7:139717357-139717379 GCTTTCTACTGAAACTCAGGAGG + Intronic
1040683521 8:49842535-49842557 CCTTGCGGCAGCAACTTGGGGGG - Intergenic
1048329746 8:133463611-133463633 GCTGTGGGCAGAAACCCGGCTGG - Intronic
1055257251 9:74386121-74386143 CCTTTAGGCAGAAAATAGGGTGG - Intergenic
1057376922 9:94533415-94533437 GCTGTCTGCAGTAACTCAGGTGG + Intergenic
1059228259 9:112693299-112693321 TCTTTAGGCAGAAAGTGGGGAGG - Intronic
1201796915 Y:17905917-17905939 GCTTTCAGCAGAGACTGTGGTGG - Intergenic
1201804638 Y:18000068-18000090 GCTTTCAGCAGAGACTGTGGTGG + Intergenic
1202358290 Y:24074976-24074998 GCTTTCAGCAGATACTGTGGTGG - Intergenic
1202512488 Y:25595137-25595159 GCTTTCAGCAGATACTGTGGTGG + Intergenic