ID: 1117156842

View in Genome Browser
Species Human (GRCh38)
Location 14:52950689-52950711
Sequence CTTTCGGCAGAAACTCGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 57}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117156822_1117156842 27 Left 1117156822 14:52950639-52950661 CCGAATTCGCAGCGCCGGCCACG 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1117156842 14:52950689-52950711 CTTTCGGCAGAAACTCGGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 57
1117156821_1117156842 30 Left 1117156821 14:52950636-52950658 CCACCGAATTCGCAGCGCCGGCC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1117156842 14:52950689-52950711 CTTTCGGCAGAAACTCGGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 57
1117156831_1117156842 9 Left 1117156831 14:52950657-52950679 CCACGGGCTGGGAGGTGGTGGAG 0: 1
1: 0
2: 8
3: 72
4: 552
Right 1117156842 14:52950689-52950711 CTTTCGGCAGAAACTCGGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 57
1117156829_1117156842 13 Left 1117156829 14:52950653-52950675 CCGGCCACGGGCTGGGAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 243
Right 1117156842 14:52950689-52950711 CTTTCGGCAGAAACTCGGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117156842 Original CRISPR CTTTCGGCAGAAACTCGGGA GGG Intronic
906583408 1:46955107-46955129 CTTTCTGCAGAAACTAAGGGAGG + Intergenic
918243071 1:182637054-182637076 CTTTCGGCAGATTCAGGGGATGG + Intergenic
918406801 1:184219502-184219524 ATTTGGGCAGAATCTCTGGAGGG + Intergenic
920425233 1:205869699-205869721 CTTTCTGGAGAGACTCAGGAAGG - Intergenic
1066301561 10:34101800-34101822 CTTTCAGTAGAGACTCTGGAGGG - Intergenic
1066584012 10:36912387-36912409 CTCTCGGCAGAAACTCTACAAGG - Intergenic
1070764149 10:79047028-79047050 CTTAGGGCAGGAACACGGGAGGG - Intergenic
1071287403 10:84161796-84161818 CTTTAGGCTGAAACTTGGGCTGG + Intergenic
1073448625 10:103596010-103596032 ATTTAGCCAGAAACTCAGGAAGG + Exonic
1077612066 11:3649432-3649454 CATTGGGCAGAGACTAGGGAGGG - Intronic
1091566304 12:1651001-1651023 CTTTCAGCAGAATATCAGGAGGG + Intergenic
1091692270 12:2605351-2605373 CTTAGGGCAGACACTTGGGATGG - Intronic
1094712007 12:32973759-32973781 CTTTGGTCAGAATTTCGGGAGGG - Intergenic
1096354474 12:50928637-50928659 CTTTAGGCAGACAGTAGGGAAGG - Intronic
1109629342 13:65024170-65024192 CTTTCAGCAGAAACTCTACAAGG - Intergenic
1113737563 13:112689698-112689720 TTTCCGGCAGGAACCCGGGAAGG + Intergenic
1114891314 14:26927188-26927210 CATGCTGCAGAAACTCAGGAGGG + Intergenic
1117156842 14:52950689-52950711 CTTTCGGCAGAAACTCGGGAGGG + Intronic
1118728088 14:68644595-68644617 CTTTAGGCAGAGATTCAGGAAGG - Intronic
1120228938 14:81821971-81821993 CTTTAGGCAGAAAACAGGGAGGG + Intergenic
1121759518 14:96433012-96433034 CTCTCGGCAGAAACTCTACAAGG - Intronic
1122444643 14:101760631-101760653 CTTGCGGGAGAAACTGCGGAGGG + Intergenic
1122817527 14:104320935-104320957 CTCTCGGCAGAGGCTGGGGAAGG + Intergenic
1132514663 16:360567-360589 CTCTGGGCAGAACCTGGGGAAGG + Intergenic
1143618713 17:8069041-8069063 CATTGGGCAGAAACTGGGGAAGG - Intergenic
1146707385 17:35011148-35011170 CTTTCCGCATAAACTAAGGATGG + Exonic
1155774032 18:29736684-29736706 CTTTCAGAAGAAACTCTGCAAGG - Intergenic
1162502068 19:11059794-11059816 CGTGCGGCAGAAAATCGAGAAGG + Exonic
1167676126 19:50887220-50887242 CTTTCCGCAGAGGCTCAGGATGG + Intergenic
927606777 2:24492242-24492264 CTTTCGGCTGAATCCCAGGAAGG - Intronic
929124733 2:38512850-38512872 CTTTCTGCATAAACCCAGGAAGG - Intergenic
933579225 2:84105797-84105819 CTCTCGGCAGAAACTCTACAAGG + Intergenic
935059848 2:99597773-99597795 CCTTGGGCAGAAACCCCGGATGG - Intronic
945495966 2:210507176-210507198 CTCTCGGCAGAAACTCTAGAAGG + Intronic
1172591592 20:36121841-36121863 CTTTGGGCAGGAAGTGGGGAAGG + Intronic
1177174496 21:17689526-17689548 CTCTGGGCAAGAACTCGGGAGGG - Intergenic
1179641845 21:42752892-42752914 CTCTCGGCAGAAACCAGGAATGG + Intronic
1180657668 22:17436880-17436902 CTTTAGGCAGGAACTGGGGGTGG + Intronic
1181327544 22:22061359-22061381 CTTTCGGCAGCAGCCAGGGAAGG + Intergenic
953038941 3:39237811-39237833 CTCTCAGGAGAAACTCCGGAGGG - Intergenic
959751508 3:109841995-109842017 ATTAAGGCAGAAACTCTGGAAGG + Intergenic
976837423 4:89390993-89391015 CTATCGGCAGAAACTCTACAAGG + Intergenic
977144806 4:93425433-93425455 CTTTCCCCAGAAACTCCAGAAGG - Intronic
984434287 4:179688761-179688783 CTTTAGCCAGAAAATCAGGAGGG + Intergenic
987987886 5:25173235-25173257 CTTTCAGCTGAAACTCTGAAAGG - Intergenic
994169913 5:96647759-96647781 CTTTCTGAAGGAGCTCGGGAAGG - Intronic
998173767 5:139887595-139887617 CTTTGGGCTGGAACTGGGGAAGG + Intronic
998486247 5:142505028-142505050 TTTTCAGCAGAAACAAGGGATGG - Intergenic
1000186455 5:158863292-158863314 CTGTCGGGAGGAACTTGGGAAGG - Intronic
1001088860 5:168722162-168722184 CTTTGGGCAGAGAGTGGGGAAGG + Intronic
1004175525 6:13336624-13336646 CTTGTGGCAGAAACTCGGCTTGG + Intergenic
1005846277 6:29781549-29781571 CTCTCGGCAGAAACTCTACAAGG + Intergenic
1007662188 6:43493643-43493665 CTTTAGGCAGAACCCCGGAAAGG + Intronic
1010483036 6:76377801-76377823 CTCTCAGCAGAAACTCAGAAGGG - Intergenic
1016245136 6:141971316-141971338 CTCTCGGCAGAAACTCTACAAGG + Intergenic
1017923481 6:158890861-158890883 CTTTGGGGAAAAACTCAGGAAGG - Intronic
1034570871 7:151955411-151955433 CTTTCTGCAGAAACTCCAGTTGG + Intergenic
1037920549 8:22802405-22802427 CTTTGGGCAGAAACTGGAGAAGG - Intronic
1040273472 8:45984369-45984391 CTCTCGGCAGAAACTCTACAAGG - Intergenic
1052800207 9:32959597-32959619 CTCTCGGCAGAAACTCTACAAGG + Intergenic
1059228258 9:112693298-112693320 CTTTAGGCAGAAAGTGGGGAGGG - Intronic
1062084998 9:134643803-134643825 TTTTCCCCAGAAACTCAGGAGGG + Intronic