ID: 1117156842

View in Genome Browser
Species Human (GRCh38)
Location 14:52950689-52950711
Sequence CTTTCGGCAGAAACTCGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 57}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117156821_1117156842 30 Left 1117156821 14:52950636-52950658 CCACCGAATTCGCAGCGCCGGCC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1117156842 14:52950689-52950711 CTTTCGGCAGAAACTCGGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 57
1117156822_1117156842 27 Left 1117156822 14:52950639-52950661 CCGAATTCGCAGCGCCGGCCACG 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1117156842 14:52950689-52950711 CTTTCGGCAGAAACTCGGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 57
1117156829_1117156842 13 Left 1117156829 14:52950653-52950675 CCGGCCACGGGCTGGGAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 243
Right 1117156842 14:52950689-52950711 CTTTCGGCAGAAACTCGGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 57
1117156831_1117156842 9 Left 1117156831 14:52950657-52950679 CCACGGGCTGGGAGGTGGTGGAG 0: 1
1: 0
2: 8
3: 72
4: 552
Right 1117156842 14:52950689-52950711 CTTTCGGCAGAAACTCGGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117156842 Original CRISPR CTTTCGGCAGAAACTCGGGA GGG Intronic