ID: 1117156845

View in Genome Browser
Species Human (GRCh38)
Location 14:52950698-52950720
Sequence GAAACTCGGGAGGGCGGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 246}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117156829_1117156845 22 Left 1117156829 14:52950653-52950675 CCGGCCACGGGCTGGGAGGTGGT 0: 1
1: 0
2: 1
3: 24
4: 243
Right 1117156845 14:52950698-52950720 GAAACTCGGGAGGGCGGCGGCGG 0: 1
1: 0
2: 0
3: 12
4: 246
1117156831_1117156845 18 Left 1117156831 14:52950657-52950679 CCACGGGCTGGGAGGTGGTGGAG 0: 1
1: 0
2: 8
3: 72
4: 552
Right 1117156845 14:52950698-52950720 GAAACTCGGGAGGGCGGCGGCGG 0: 1
1: 0
2: 0
3: 12
4: 246
1117156838_1117156845 -8 Left 1117156838 14:52950683-52950705 CCGGGGCTTTCGGCAGAAACTCG 0: 1
1: 0
2: 0
3: 0
4: 47
Right 1117156845 14:52950698-52950720 GAAACTCGGGAGGGCGGCGGCGG 0: 1
1: 0
2: 0
3: 12
4: 246
1117156837_1117156845 -7 Left 1117156837 14:52950682-52950704 CCCGGGGCTTTCGGCAGAAACTC 0: 1
1: 0
2: 1
3: 4
4: 102
Right 1117156845 14:52950698-52950720 GAAACTCGGGAGGGCGGCGGCGG 0: 1
1: 0
2: 0
3: 12
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117156845 Original CRISPR GAAACTCGGGAGGGCGGCGG CGG Intronic