ID: 1117161617

View in Genome Browser
Species Human (GRCh38)
Location 14:52995341-52995363
Sequence AGGGAGAGCACAGTGACTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117161617_1117161625 14 Left 1117161617 14:52995341-52995363 CCCATAGTCACTGTGCTCTCCCT No data
Right 1117161625 14:52995378-52995400 GATTCTCTCTCTGCACCATGTGG No data
1117161617_1117161628 27 Left 1117161617 14:52995341-52995363 CCCATAGTCACTGTGCTCTCCCT No data
Right 1117161628 14:52995391-52995413 CACCATGTGGCCACTGCCAGGGG No data
1117161617_1117161627 26 Left 1117161617 14:52995341-52995363 CCCATAGTCACTGTGCTCTCCCT No data
Right 1117161627 14:52995390-52995412 GCACCATGTGGCCACTGCCAGGG No data
1117161617_1117161626 25 Left 1117161617 14:52995341-52995363 CCCATAGTCACTGTGCTCTCCCT No data
Right 1117161626 14:52995389-52995411 TGCACCATGTGGCCACTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117161617 Original CRISPR AGGGAGAGCACAGTGACTAT GGG (reversed) Intergenic