ID: 1117166252

View in Genome Browser
Species Human (GRCh38)
Location 14:53036922-53036944
Sequence CTGTGGGTGAGGAGGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1035
Summary {0: 1, 1: 0, 2: 6, 3: 110, 4: 918}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117166252_1117166259 23 Left 1117166252 14:53036922-53036944 CCTTCTGCCCTCCTCACCCACAG 0: 1
1: 0
2: 6
3: 110
4: 918
Right 1117166259 14:53036968-53036990 GTTCCCACCTTTGCATCCTGAGG 0: 1
1: 0
2: 1
3: 19
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117166252 Original CRISPR CTGTGGGTGAGGAGGGCAGA AGG (reversed) Intronic
900151106 1:1179732-1179754 CTGTTGGTGAGGAGGGTCGGAGG + Exonic
900277174 1:1838320-1838342 GTCTGGGTGAGGAGGGTACATGG - Intronic
900382221 1:2390603-2390625 ATGTCGGGGAGGAGGGCAGGGGG + Intronic
900555775 1:3279666-3279688 CTGTGCTGCAGGAGGGCAGAGGG + Intronic
900571699 1:3361828-3361850 CTGTGGCCCAGGAGGGCAGGTGG + Intronic
900585889 1:3432171-3432193 CTCTGGCTGAGGAGGCCAGGTGG - Intronic
900666716 1:3820503-3820525 CTGGGGTGGAGGAAGGCAGATGG + Intronic
901125895 1:6928520-6928542 GTTAGGGTGGGGAGGGCAGATGG - Intronic
901465190 1:9416901-9416923 CTGTGGCTGAGGGAGGCACAGGG - Intergenic
901691498 1:10976257-10976279 CTGCGGGAGAGGAGGGAAGGGGG + Intronic
901856176 1:12045518-12045540 TTGTCGGTGACCAGGGCAGAGGG - Intergenic
901886842 1:12229724-12229746 CTGTGGGTGAGTGGGCCAGACGG + Intergenic
902375370 1:16027800-16027822 CTCTGGGGAAGGAGGGCAGTGGG - Exonic
902380334 1:16049597-16049619 CTCTGGGGAAGGAGGGCAGTGGG - Exonic
902439184 1:16418159-16418181 CTGTGGGGGAGAAGAGGAGAGGG - Intronic
902532367 1:17098743-17098765 CTGAGGGTGAAGGGGCCAGAAGG - Intronic
902539095 1:17139805-17139827 ATGTGGGTGGGGAAGGCAGGGGG + Intergenic
902615129 1:17619448-17619470 CTGTGGGGGAGTGGGGCAGGTGG + Intronic
902618313 1:17635855-17635877 CTGTGGGTGAGAAAGGCACTGGG + Intronic
902775360 1:18671124-18671146 CTGTGGGGCAGGAAGGCAGCAGG + Intronic
902790780 1:18766389-18766411 GGGTAGGTGAAGAGGGCAGAGGG + Intergenic
902888860 1:19426759-19426781 CTGTGGGTCAGGAGTTCAGGAGG - Intronic
902917417 1:19646953-19646975 CTGTGGGAGCGAGGGGCAGAAGG + Intronic
902951950 1:19891596-19891618 TTGGAGGTGAGGAGGGGAGAGGG + Intronic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
903539682 1:24089947-24089969 GTGTGGGGGATGAGGGCAGGTGG - Intronic
903756360 1:25664133-25664155 CAGAGCGTGTGGAGGGCAGATGG - Intronic
903789997 1:25886243-25886265 CAGTGGGAGGGAAGGGCAGAGGG + Intronic
903790297 1:25888245-25888267 GAGTGGGTGAGGAGGGCTGTGGG + Intronic
904041823 1:27589900-27589922 GTGGGGGTGCTGAGGGCAGAAGG - Intronic
904089675 1:27935957-27935979 GTGGGGGTGAGGTTGGCAGATGG + Intronic
904287835 1:29463531-29463553 CTGTGTGTGTGGTGGGCAGGGGG - Intergenic
904912983 1:33949334-33949356 CAGTGGCTGGGGAGGGCAGATGG + Intronic
905979638 1:42211890-42211912 CTGGGGGTGAGGAGGGCCAGGGG + Intronic
906034385 1:42741337-42741359 CTGTGGGGGAGGAAGCCAGCAGG - Intergenic
906106732 1:43299162-43299184 TTGAGAGTGGGGAGGGCAGATGG + Intergenic
906290702 1:44617672-44617694 CTGATGGTGAGGAGTGGAGAGGG - Intronic
906326667 1:44850439-44850461 CTGTGGGTGAGGTGGGGGAAGGG + Intergenic
906886151 1:49650996-49651018 CTCTGTGTACGGAGGGCAGATGG - Intronic
907461513 1:54608283-54608305 CTCTGGGTGCTGAAGGCAGAAGG + Intronic
907474819 1:54698648-54698670 CCGTGGGTGGGGAGGCCAGTGGG + Intronic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
908062449 1:60366764-60366786 TTCTGGGAGAGGAGGGAAGAGGG + Intergenic
909445217 1:75742145-75742167 CTGGGGGTGGGGAGGGGGGAAGG - Intronic
909786341 1:79618631-79618653 GTGGGGGTGAGGATGGGAGATGG + Intergenic
909988282 1:82189571-82189593 CTGGTGATGAGGAGGGAAGAGGG - Intergenic
910210484 1:84787620-84787642 CTGTGGGAGAGGACGGCAATGGG + Intergenic
910212455 1:84807318-84807340 CTAGAGATGAGGAGGGCAGAGGG + Intergenic
910241088 1:85086941-85086963 CTGTGGGAGATTAGGGCAGAGGG - Intronic
910451552 1:87351754-87351776 GTGTGGGTGGGTAGGGCAGAGGG - Intergenic
910502411 1:87908034-87908056 GTGGGGGTGGGGTGGGCAGAAGG + Intergenic
910542655 1:88378645-88378667 CTGAGGGGGAGGAGGGAACATGG - Intergenic
910631658 1:89361943-89361965 CTTTCGGTGAGTAGGGCAGATGG - Intergenic
910640584 1:89457185-89457207 CTTTGGGTGAGTAGGGCAGATGG + Intergenic
911027223 1:93448300-93448322 CTGTGGGTGAGTCGGGGAGAGGG + Exonic
911597148 1:99810614-99810636 TGGTGGGTGATGAGGTCAGAGGG + Intergenic
912451456 1:109770104-109770126 CTGTGGGAGGGCAGGGGAGAAGG + Intronic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
912814134 1:112815451-112815473 GTGAAGGTGAGGAGGGGAGAAGG - Intergenic
912823478 1:112885596-112885618 CTGAGGGTGAGCTGGGAAGAAGG - Intergenic
913063913 1:115232255-115232277 ATGGGGATGGGGAGGGCAGAGGG + Intergenic
915042636 1:152981698-152981720 AGGTGGGTGGGGAGGGCAGCAGG + Intergenic
915120954 1:153629279-153629301 CTGTGGCTGATGAGGGGATAAGG - Intronic
915279242 1:154810925-154810947 ATGTGGCTGGTGAGGGCAGAGGG - Intronic
915288861 1:154869646-154869668 CGGTGGGAGAGGAGTGCAGCAGG + Exonic
915462060 1:156076226-156076248 CAGCGGGGGAGGTGGGCAGAGGG + Exonic
915490296 1:156246840-156246862 CTGTGCGTGTGGGAGGCAGATGG + Intronic
915545105 1:156592495-156592517 CTGTGGGGGAGGAGGGCGTGAGG + Intronic
915974722 1:160377651-160377673 GTGTTGGTGAGGAAGGCAGCCGG + Intergenic
916898835 1:169198701-169198723 CTGAGGGTGAGGTGGGAAGTAGG + Intronic
918123019 1:181556484-181556506 CTGTGGGAGGGGGAGGCAGAGGG + Intronic
919724816 1:200874614-200874636 TTGTGAGTGAGAAGGGCAGGGGG - Intergenic
919729079 1:200901494-200901516 CTGTGGGCCTGGAGGGCAGCGGG - Intronic
919735763 1:200949464-200949486 GTGAGGGAGAGGAGCGCAGATGG + Intergenic
919897115 1:202015857-202015879 CTGTGGGAGAGGAGTGGGGAGGG - Exonic
920679647 1:208062736-208062758 CTGGGGGTGAGGGTGGGAGAAGG + Intronic
920816000 1:209332631-209332653 GTGTTGGTAAGGAGGGCAGAAGG - Intergenic
920849998 1:209622353-209622375 GAGTGGGTGGGGAGGGCAGACGG + Intronic
920954626 1:210607029-210607051 CTGGGGGTGAAGAAGGAAGAGGG + Intronic
921194991 1:212747189-212747211 CTGTGGGAGAGGACTGCACAAGG - Intronic
921265015 1:213414962-213414984 GGGTGGGTGTGGAGGCCAGAGGG + Intergenic
921407828 1:214800053-214800075 CTGTGGGTCATGAGGGCAGAAGG + Intergenic
921956973 1:220994884-220994906 CTGTGGATGTGGTGGGGAGAAGG + Intergenic
922345643 1:224694075-224694097 CTGTGGAGGAGGAGAGGAGAGGG + Intronic
922702431 1:227769698-227769720 CTGTGGTTGTGGAGGGTGGAGGG + Intronic
922707381 1:227796529-227796551 CTGTGGGTGGGGCCGGCAGTAGG - Intergenic
922910688 1:229213697-229213719 CTGTGGGCAAGGAGGAAAGAAGG + Intergenic
923360156 1:233203262-233203284 CTGTGGGTGAGAAAGCCAAAAGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923570042 1:235105265-235105287 CTGTGGGAGAGGAAGGCTGTGGG + Intergenic
924043890 1:240009241-240009263 CTGAGGGTGAGGAGGCCTGGAGG + Intergenic
924411050 1:243806065-243806087 TTTTGGGTGAGAAGGGAAGAAGG - Intronic
924664620 1:246058325-246058347 AGGTGGGGGAGGAGGGCAGGAGG + Intronic
1062796536 10:348683-348705 CTGTGGGTGCGGGGGACGGACGG + Exonic
1063044485 10:2377655-2377677 CTGTGGCTGAGGTGAGCAGCAGG + Intergenic
1063497585 10:6524743-6524765 AAGTGGGTGAGGAGGGAGGAGGG + Intronic
1063529761 10:6819692-6819714 CTGGGGCTGAGGAGAGGAGAAGG + Intergenic
1063665406 10:8057834-8057856 CTGTGAGTGAGGAGGCCTGAAGG - Intronic
1064102154 10:12473088-12473110 ATGTGGGGCAGGAGGGGAGAGGG + Intronic
1064476229 10:15691688-15691710 CAGAGGCTGGGGAGGGCAGAAGG + Intronic
1064717634 10:18193390-18193412 CTGTGGGTGTGAAGTGCAGGTGG + Intronic
1065072892 10:22045710-22045732 CTGTGGGTCAGGAATCCAGAAGG - Intergenic
1065099705 10:22321191-22321213 CTGTGGGGGAGGCGGGCGGGCGG - Exonic
1065176536 10:23081730-23081752 CTGCCGGTGAGGAGGTCTGAGGG + Intergenic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1066668598 10:37812731-37812753 CTCTAGATGAGGAGGGCATAAGG + Intronic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067095766 10:43298661-43298683 CTGTGGAGGAGGAGGACATAGGG - Intergenic
1067431846 10:46250468-46250490 CTGTGGGAGGAGGGGGCAGATGG - Intergenic
1067441574 10:46311710-46311732 CTGTGGGAGGAGGGGGCAGATGG + Intronic
1067732871 10:48825104-48825126 CAGTGGGTGGGGTGGGGAGAGGG - Intronic
1068395631 10:56457348-56457370 CTGGGGATGAGGATGCCAGATGG - Intergenic
1069035967 10:63646214-63646236 CGGCGGGTGGGGAGGGCAGGGGG + Intergenic
1070483727 10:76910235-76910257 CTTTGGGTAAGGGGGGCAGTGGG + Intronic
1070782672 10:79146669-79146691 CTCTGGGTGGGGAGGGCGGAAGG + Intronic
1070976421 10:80609350-80609372 CGGAGGGAGAGGAAGGCAGAGGG - Intronic
1071017477 10:81015054-81015076 ATGTGTGTGAGGGGGGCAGAGGG + Intergenic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1071293002 10:84200925-84200947 CTGGGGATGTGGAGGGCTGAGGG - Intronic
1071293470 10:84203223-84203245 CTCTGTGTGAGGAGGGCAACCGG - Intronic
1071380949 10:85058988-85059010 CTGTTGTTGAGTAGGGGAGAAGG + Intergenic
1071463621 10:85920753-85920775 CTGTGGGCGGGGAGGGAAGGGGG + Intronic
1071499355 10:86192510-86192532 CAGTGGGTGCTGAGGGCTGAAGG + Intronic
1071529029 10:86375074-86375096 ATGTGGGAATGGAGGGCAGAGGG - Intergenic
1071571574 10:86700195-86700217 CTGTGGGGCAGGAGAGCAGCAGG - Intronic
1071843529 10:89498225-89498247 GTGGGGGTGAGGTGGGAAGATGG + Intronic
1072189570 10:93068919-93068941 CTCTGGGCGCGGAGCGCAGAAGG - Intergenic
1072845418 10:98825184-98825206 ATGTGTGTGAGGTGGGGAGAGGG + Intronic
1072975922 10:100057710-100057732 ATTTTGGTGAGGTGGGCAGATGG + Intronic
1073073105 10:100807281-100807303 CTGTGGGTGAGGGGAGCAGGTGG - Intronic
1073470691 10:103720441-103720463 CAGTGGGGGAGGTGGGCAGCAGG - Intronic
1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG + Intergenic
1074165763 10:110872349-110872371 CAGAGGGGGAGGAGGGCTGAGGG - Intronic
1074313239 10:112340473-112340495 CTGTGGGTGAGAACTGTAGATGG - Intergenic
1074603367 10:114936855-114936877 CTGGGGGTGAGGGATGCAGAGGG - Intergenic
1074704415 10:116118466-116118488 CAGTGGTTGAGGTGGGAAGAAGG - Intronic
1074707452 10:116147617-116147639 CTCTGTGTGAGGATGGCAGGTGG - Intronic
1074915423 10:117950713-117950735 CTGTGAGCCAGGAGAGCAGATGG + Intergenic
1075098905 10:119492056-119492078 ATGGGGGTGAGAGGGGCAGAAGG + Intergenic
1075265663 10:120998240-120998262 CGTTGGGGGAGGAGGGCAGTGGG - Intergenic
1075397984 10:122141499-122141521 CTGTGGGTGTTAAGGGCAGGCGG + Intronic
1075404213 10:122183754-122183776 CCGTGAGTGGGGAGGGCAGTTGG + Intronic
1075777704 10:124998973-124998995 CTCTGGCTGAGGAGGGTAAATGG - Intronic
1076063349 10:127430055-127430077 CTGTAGGTGGGGAGGGGAGAGGG - Intronic
1076076014 10:127534439-127534461 CTGTGGATGGGAAGGGGAGACGG - Intergenic
1076150582 10:128159230-128159252 GTGTGGGAGAGCAGGGCAAAGGG + Intergenic
1076689341 10:132213336-132213358 CTGTGGGTGTGTTGGGAAGATGG - Intronic
1076919582 10:133444770-133444792 GTCTAGGTGAGGAGGGCAGAGGG - Intergenic
1077066563 11:643679-643701 CTCTTGGTCAGGAGGGCAGGGGG + Intergenic
1077251924 11:1564555-1564577 GGGTGGGGGAGGAGGGCAGGAGG - Intronic
1077333326 11:1992921-1992943 CTCAGGGTGAGGCGGGCAGGCGG - Intergenic
1077544179 11:3161954-3161976 CTGTGAGCAAGGAGGGGAGAGGG + Intronic
1077560964 11:3260722-3260744 CTGTGGGAGAGGAGGGTAATTGG + Intergenic
1077566861 11:3306552-3306574 CTGTGGGAGAGGAGGGTAATTGG + Intergenic
1077920688 11:6639924-6639946 CTGTGGCAGAGGAGGCTAGAGGG + Exonic
1077998683 11:7475664-7475686 TATTGGGTGAGGAGGGGAGAAGG + Intergenic
1078652983 11:13213174-13213196 CTATGGCTGTAGAGGGCAGAGGG + Intergenic
1078657954 11:13259965-13259987 CTGTGTGGGCGGGGGGCAGAGGG + Intergenic
1079329581 11:19522498-19522520 CGGCTGGTGAGGAGGGAAGAAGG - Intronic
1080428651 11:32178738-32178760 CTTTGGGAGCAGAGGGCAGAAGG - Intergenic
1081630795 11:44688332-44688354 ATGTGGGTGAGGAAGAGAGAGGG - Intergenic
1081968314 11:47182759-47182781 TTGGGGCTGTGGAGGGCAGAGGG + Exonic
1082856071 11:57807896-57807918 CTATGGGAGAGGAGGCAAGAAGG + Intronic
1082932712 11:58625364-58625386 TTGGCGGTGAGGAGGGCAGCTGG + Exonic
1083259921 11:61517372-61517394 CTGTGAGTGAGTCGGGCAGAAGG + Intronic
1083481280 11:62949215-62949237 CTGTGGATGGGGATGGCAGCAGG + Intronic
1083594219 11:63911414-63911436 CAGGGGGGGAGGTGGGCAGAGGG - Exonic
1083712116 11:64555892-64555914 CTGAGGGGCAGGAAGGCAGAAGG + Exonic
1084043705 11:66557110-66557132 CTGTGGGGGGAGTGGGCAGAAGG - Intronic
1084075339 11:66770797-66770819 CGATGGGTAAGGAGGCCAGAAGG - Intronic
1084214414 11:67639772-67639794 CTGTGCGGGAGGAGGGCAGGTGG + Intergenic
1084422002 11:69065176-69065198 CTGTGGGTGGTGGGGGCAGCTGG + Intronic
1084456769 11:69272393-69272415 CAGTGGGACAGGTGGGCAGATGG - Intergenic
1084662866 11:70557462-70557484 CAGTGGGGGAGGAGCCCAGATGG + Intronic
1084665417 11:70573710-70573732 CTGAGGGTGAGGAGGGGAAACGG + Intronic
1084678182 11:70649114-70649136 ATATGGGTGAGAAGGGGAGATGG - Intronic
1085047698 11:73363039-73363061 CTGTCGGTGAGCAGGGCAGCAGG + Intronic
1085122158 11:73974162-73974184 CTGTGGCTGTGGAGGGTGGAAGG + Intergenic
1085345782 11:75767518-75767540 CTGTAGGTCAGGAGGGCAGTGGG - Intronic
1086436998 11:86791361-86791383 ATCTGTGTGCGGAGGGCAGAAGG + Intronic
1086806319 11:91247257-91247279 ATGTGTGTGTGGAGGGGAGAAGG + Intergenic
1086917488 11:92547625-92547647 CTGGGGGTGAGAAGGGGAGAGGG - Intronic
1087091852 11:94281703-94281725 CTGGGGGTGAGGAGGGGAGGTGG + Intergenic
1087428331 11:98018343-98018365 CTGTTGGGGAGTAGGGCACAAGG + Intergenic
1087491766 11:98837075-98837097 CTGAGGGTGTGGAGGGTGGAGGG - Intergenic
1088276428 11:108091449-108091471 GGGAGGCTGAGGAGGGCAGATGG + Intronic
1088469546 11:110178030-110178052 TGGTGGGTGGGGAGGGCAGATGG - Intronic
1088843244 11:113644211-113644233 CTGAGGGAGAGAAGGGCAGGCGG - Intergenic
1089118102 11:116112494-116112516 CTGTGGGTGATGAGGGTGGAGGG + Intergenic
1089151183 11:116365657-116365679 CTCAGGGTGAGGATGGGAGAGGG - Intergenic
1089440554 11:118512993-118513015 CTTTGGGTGACCAAGGCAGAAGG + Intronic
1089505306 11:118958347-118958369 CTAGGGGAGAGGAGGGCAGGAGG - Exonic
1089538102 11:119173016-119173038 CAGGGGGTGTGGTGGGCAGACGG + Intronic
1089636240 11:119814281-119814303 CTGTGGGTGAGGAATGCAGCAGG - Intergenic
1089771795 11:120808509-120808531 CTGTTGGTGAGGAGAGGCGATGG + Intronic
1089808468 11:121112974-121112996 CTGTGGGTGGGGAGGGCGCAGGG + Intronic
1090096401 11:123746002-123746024 CTGGGGGTGAGGTTGGGAGATGG + Intergenic
1090313429 11:125763885-125763907 CTGAGGGTGTGGAAGGCAGGAGG - Intergenic
1090408826 11:126493721-126493743 CTGTGGGTGAGGGGGGCTGTAGG - Intronic
1090447707 11:126778107-126778129 CTCTGGGTGGGGAGGTCAGGGGG - Intronic
1090879455 11:130820873-130820895 CTGAGGGTGAGGAGGTCAGCTGG - Intergenic
1091192931 11:133709247-133709269 CTGAAGGTGGGGAGGGGAGAGGG - Intergenic
1091228154 11:133970547-133970569 CTGTGAGTGAAGAGTGAAGATGG - Intergenic
1091311840 11:134580454-134580476 CTGTGGGTGGGGAGCTCTGAGGG + Intergenic
1202816306 11_KI270721v1_random:48102-48124 CTCAGGGTGAGGCGGGCAGGCGG - Intergenic
1091395585 12:152439-152461 GTGAGGGAGAGGAGGGCACAGGG + Intronic
1091404524 12:200902-200924 CTGTGGGGGAGGTGGGGAGTGGG - Intronic
1091590004 12:1837227-1837249 CGGTGGGAGGGGAGGGCAGTTGG + Intronic
1091675601 12:2486809-2486831 AGGTGGGGGAGGAGGGCAGGTGG + Intronic
1091706307 12:2695644-2695666 CTGGGGCTGGGGAGGGCAGTGGG - Intronic
1091711535 12:2743873-2743895 CTGGGGCTGGGGAGGGCAGTGGG - Intergenic
1091796911 12:3302756-3302778 CTGTGGATATGGAGGGCTGATGG + Intergenic
1092126915 12:6080950-6080972 CAGTGGGTGGGGTGGGCAGCAGG + Intronic
1093053501 12:14532088-14532110 CCGTGGGTGAGGAGTGAAGGTGG - Intronic
1093244192 12:16715155-16715177 GTGTGGGAGAGGAGTGGAGAGGG + Intergenic
1093484863 12:19641677-19641699 CTGTGGGGGAGGAAGGGAAATGG - Intronic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1094812449 12:34151689-34151711 ATGTTGGGAAGGAGGGCAGAGGG - Intergenic
1095329347 12:40939011-40939033 CAGAGGCTGAGGTGGGCAGATGG - Intronic
1095814536 12:46406985-46407007 AAGTGGGTGGGGAGGGAAGATGG - Intergenic
1096573892 12:52540736-52540758 CTGGGGCTGAGGAGAGCAGCAGG - Intergenic
1096626674 12:52900066-52900088 CTGTGGGGGAAGAGGGCAAGTGG + Intronic
1096801883 12:54115789-54115811 CTGGGGGTGAGGATGTCAAACGG + Intergenic
1097169585 12:57105340-57105362 CTGGGAGTGAGGAGGACACAAGG + Intronic
1097839085 12:64303430-64303452 ATGTGTGTGTGGAGGGGAGATGG - Intronic
1099640788 12:85280664-85280686 CTTTGGGGGCGGAGGGCGGAGGG + Intronic
1101323955 12:103698284-103698306 CTGTGGGGAAGGAGAGGAGAAGG - Intronic
1101371052 12:104130913-104130935 TTGGGGGTGGGGAGGGCAGGCGG + Intronic
1101653777 12:106701790-106701812 CTTTGGGAGATGAAGGCAGAAGG + Intronic
1101706297 12:107224138-107224160 CTGGGGGTGAGGAGTGGAGAGGG + Intergenic
1101725611 12:107385855-107385877 ATGTCGGTGAGGATGGCAGGAGG - Intronic
1101894903 12:108749022-108749044 CTTTGGGAGATCAGGGCAGAAGG + Intergenic
1101985570 12:109443925-109443947 CGCTAGGGGAGGAGGGCAGATGG - Intronic
1102016333 12:109650356-109650378 GAGAGGCTGAGGAGGGCAGATGG + Intergenic
1102123167 12:110458971-110458993 CTGAGGGTGAGGAAGGCAGAGGG - Intronic
1102611213 12:114114026-114114048 CTGAGGCTTAGAAGGGCAGAGGG - Intergenic
1102612509 12:114124852-114124874 CTGAGGCTCAGAAGGGCAGATGG - Intergenic
1102963294 12:117107594-117107616 GCGGGGCTGAGGAGGGCAGATGG + Intergenic
1102988667 12:117299016-117299038 CTGGGGCTGAGCTGGGCAGAGGG + Intronic
1103003555 12:117404567-117404589 CCATGGCTGAGGATGGCAGAAGG + Intronic
1103251774 12:119506139-119506161 CTCTGGGTAAGAAGGGCAGAAGG - Intronic
1103539975 12:121659245-121659267 CTGTTGGTCAGGAAGGCTGAGGG + Exonic
1103715868 12:122945037-122945059 CTGGGCATGAGGAGGACAGATGG - Intronic
1104009411 12:124918851-124918873 CTGTGGGAGGCCAGGGCAGAAGG - Intergenic
1104075621 12:125387145-125387167 CTGGGGGTGGGGCGGGGAGATGG + Intronic
1104247253 12:127055794-127055816 CTGTGCTTGATGAAGGCAGAGGG - Intergenic
1104476270 12:129073009-129073031 CTGTGGGTGGGGGAGGGAGAGGG - Exonic
1104510010 12:129368711-129368733 CTGTTGGTAAGGAGGAAAGAGGG - Intronic
1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG + Intronic
1104920899 12:132290238-132290260 CTGTGTGTGGTGAGGGCAGACGG - Intronic
1105213656 13:18272365-18272387 CTGTGTGTGGGGAGGGCACAGGG - Intergenic
1105640997 13:22264033-22264055 TTGTGGGTGGGGATGGCGGAAGG + Intergenic
1105885081 13:24635073-24635095 CTTTGGGTGACCAGGGCAGGAGG + Intergenic
1106456994 13:29936229-29936251 GTGTGGGTGTGGAGAGCAGTGGG + Intergenic
1106882590 13:34148253-34148275 CTGTGGGAGAGGGTGGCACATGG - Intergenic
1107119827 13:36784439-36784461 TTTTTGGTGAGGATGGCAGAAGG + Intergenic
1108270128 13:48751265-48751287 CTGAGGGTGAAGAGAGCACATGG - Intergenic
1108563856 13:51674731-51674753 ATGTGGGTGGGGAGGGTGGAGGG + Intronic
1109269336 13:60236870-60236892 CGGTGGGTGTGGAGAACAGATGG - Intergenic
1110271207 13:73592763-73592785 TTGTGGGGGAGGTGGGCAGGTGG + Intergenic
1110299768 13:73912857-73912879 CTGTGAGTGAGGGGAGAAGAAGG - Intronic
1110702366 13:78563547-78563569 CTGTGGGAGGGAAGGGCTGATGG + Intergenic
1111876381 13:93902220-93902242 CAGAGGCTGAGGAGGGGAGAGGG - Intronic
1112598247 13:100829915-100829937 GGGAGGCTGAGGAGGGCAGATGG - Intergenic
1113296394 13:108963831-108963853 ATGTGACTGAGGAGGGCAGGTGG - Intronic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1114479426 14:23023158-23023180 ATGTGGGGGAGGAGGGAGGAAGG - Intronic
1114517398 14:23308793-23308815 CTGTGGGAGAGAAGGGAAGCAGG - Intronic
1114657398 14:24324290-24324312 CTGATGGTGAGGTGGGCTGAGGG - Exonic
1114899793 14:27043415-27043437 CTGTGGGTGAAGAAGGAAAAGGG + Intergenic
1114940444 14:27603712-27603734 GTGGTGGTGAGGCGGGCAGATGG + Intergenic
1116601764 14:46934858-46934880 CAGTGGGTGAGGAAAGCACAAGG + Intronic
1116610765 14:47068938-47068960 CTGTGAGAGAGGTTGGCAGAAGG - Intronic
1116904112 14:50388669-50388691 TTTTTGCTGAGGAGGGCAGAGGG - Intronic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117414340 14:55479931-55479953 CTATGGGAGGGGAGGGGAGAGGG - Intergenic
1119404453 14:74388897-74388919 CTGTGGGTGTGGCTGCCAGATGG - Intergenic
1119472235 14:74907307-74907329 ATGTGGGTGCAGAGGGCAGTAGG - Intronic
1119543784 14:75457405-75457427 CTGTGGGGCATGAAGGCAGAGGG + Intronic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1119730517 14:76948175-76948197 CTGTGGGTGAGGGGAGGTGAGGG - Intergenic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1121183232 14:91945322-91945344 TTGTGGGTGTGGATGCCAGATGG + Intronic
1121323188 14:93004773-93004795 GTGTGGGTGCGGGGGGCACAGGG + Intronic
1121469206 14:94138882-94138904 GTGGGGGTGAGCAGGGCTGACGG + Intergenic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1122144263 14:99679934-99679956 CAGTGGGGGAGGAGGGGCGAGGG - Exonic
1122221009 14:100239146-100239168 CCGTGGGGAAGGAAGGCAGAGGG - Exonic
1122309176 14:100783733-100783755 GTGTGGTTGAGGAGGGGAGCTGG + Intergenic
1122429448 14:101630553-101630575 GTGTGGGGTAGGAGGGCAGAGGG - Intergenic
1122597613 14:102904034-102904056 CTGTGGGTGCTGAGGCCGGAGGG + Intronic
1122785974 14:104163437-104163459 CTTTGGGCGACGAGGGCACAAGG + Intronic
1123038416 14:105480614-105480636 GTGTGGCTGAGGAGGGAAGGGGG + Intergenic
1123103235 14:105819651-105819673 CCGTGGGTGGGGAGGGCAAATGG + Intergenic
1202889625 14_KI270722v1_random:143791-143813 ATGTGTGTCAGGTGGGCAGAGGG - Intergenic
1202889638 14_KI270722v1_random:143911-143933 ATTTGTGTCAGGAGGGCAGAGGG - Intergenic
1124031551 15:26016815-26016837 GGGAGGCTGAGGAGGGCAGATGG - Intergenic
1124584779 15:30994417-30994439 CAGTCAGGGAGGAGGGCAGAGGG + Intergenic
1125002319 15:34784391-34784413 ATGTGGGTGAGAAGGGCATGGGG + Intergenic
1125503612 15:40253915-40253937 TTCTGGGTGAAGGGGGCAGAGGG + Intronic
1126142591 15:45450224-45450246 CTGTGGATGAGAAGGGCAGGTGG + Intergenic
1126666926 15:51083778-51083800 CAGGGGGTGAACAGGGCAGAAGG + Intronic
1126783105 15:52155184-52155206 AGGTAGGTGAGGAGGGAAGAGGG + Intronic
1127318628 15:57820310-57820332 CCATGGGTGAGGAGGAGAGAGGG + Intergenic
1127455801 15:59155051-59155073 CTGGGGATGGGGAGGGTAGAAGG + Intronic
1127551688 15:60044782-60044804 TTGTGGGTGAGGAGAGGAGGTGG - Intronic
1127995984 15:64153334-64153356 CTGGGGGTAAGGGGGGCCGATGG + Exonic
1128072832 15:64807989-64808011 CTGCGGGGGAGGAGTGGAGATGG + Intergenic
1128271148 15:66311118-66311140 CTGTGGGTGGCCAGGGCAGGAGG + Intronic
1128475369 15:67992794-67992816 ATTTGGGTGAGGAGGGCTGAAGG - Intergenic
1128523352 15:68390207-68390229 TTGTGAGTGAGGTGGGAAGAAGG + Intronic
1128599655 15:68985227-68985249 CTATGTCAGAGGAGGGCAGATGG + Intronic
1128649306 15:69398824-69398846 CTGAGTCAGAGGAGGGCAGAGGG + Intronic
1128730234 15:70015811-70015833 CTGGGGGTCAGGAGGGCTGCGGG - Intergenic
1128774798 15:70311995-70312017 CTGTGATTGAGGAGGGAACAGGG - Intergenic
1129410713 15:75348861-75348883 CTGTTGGGGAGGAAGGCAGCGGG - Intronic
1129525701 15:76212732-76212754 CTGTGGGCAAGGCTGGCAGAGGG - Intronic
1129609627 15:77042983-77043005 CTGTGGGTCAGGCTGGCAAAGGG - Exonic
1129702170 15:77774330-77774352 CCCTGGGAGAGGTGGGCAGAGGG - Intronic
1130011224 15:80154230-80154252 AAGTGTTTGAGGAGGGCAGAGGG - Intronic
1130135866 15:81181500-81181522 ATGGGGGTGAGGGGTGCAGAGGG + Intronic
1130300473 15:82676644-82676666 TTGTGGGAGAGGAGTGAAGATGG + Intronic
1130392733 15:83473290-83473312 CCAGGGGTGAGGAGGGGAGAGGG + Intronic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1130546310 15:84859369-84859391 CAGTGGGCGAGGTGGGCAGGAGG + Exonic
1130796499 15:87215236-87215258 CTGTGGGTCACTGGGGCAGAGGG + Intergenic
1130877588 15:88028039-88028061 GTGAGGGTGAGGAGGGAAAATGG + Intronic
1130937967 15:88486147-88486169 CTATGGGTGATGAGGGGTGATGG + Intergenic
1131078038 15:89510685-89510707 TTGGGGGTGAGGAAGGGAGAGGG + Intergenic
1132039185 15:98510889-98510911 CTGGGGCTGGGGAGGGTAGAAGG + Intronic
1132156133 15:99496361-99496383 GTGTGGGCAGGGAGGGCAGAAGG + Intergenic
1132162318 15:99554332-99554354 CTGTGGGTGAGGTGGGGAGTGGG - Intergenic
1132353379 15:101154454-101154476 GGGTTGGTGAGGAGTGCAGATGG + Intergenic
1132771772 16:1567543-1567565 CTGTGGATGAGCAGGGAAGGAGG - Intronic
1132839283 16:1971015-1971037 GAGTGGGTGCAGAGGGCAGAGGG - Intergenic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1133299320 16:4772603-4772625 CAGAGGCTGAGGCGGGCAGATGG + Intergenic
1133320302 16:4909379-4909401 CTGAGGGTGGGGAGGTCAGGAGG - Intronic
1133845321 16:9448127-9448149 CTGTGGGTGGGTTGGGGAGATGG + Intergenic
1134224877 16:12381906-12381928 GTGTGGGTGGGGTGGGTAGATGG - Intronic
1134520779 16:14918372-14918394 CTGTGAGTGCGGCGGGCGGATGG + Intronic
1134550796 16:15137601-15137623 CTGTGAGTGCGGCGGGCGGATGG - Intronic
1134708451 16:16317023-16317045 CTGTGAGTGCGGCGGGCGGATGG + Intergenic
1134715666 16:16357056-16357078 CTGTGAGTGCGGCGGGCGGATGG + Intergenic
1134951151 16:18351622-18351644 CTGTGAGTGCGGCGGGCGGATGG - Intergenic
1134959091 16:18395103-18395125 CTGTGAGTGCGGCGGGCGGATGG - Intergenic
1135140120 16:19913974-19913996 CTCTTGGTGAGGACAGCAGATGG - Intergenic
1135552451 16:23408416-23408438 CAGGGGGTGAGCAGGGCAGAAGG + Intronic
1136014141 16:27384048-27384070 GTGTGGGTGGGGAGGGCAGAGGG - Intergenic
1136043127 16:27595972-27595994 TGGTGGGAGAGGAGGACAGAGGG + Intronic
1136187544 16:28597017-28597039 CTGCGGGCGAGGAGGGCACAAGG - Intronic
1136190017 16:28609951-28609973 CTGCGGGCGAGGAGGGCACGAGG - Exonic
1136366849 16:29812947-29812969 CTTGGGGTGAGGAGGGAAGAGGG - Intronic
1136499835 16:30664692-30664714 CTGTGGGAGGGGACGGGAGAAGG - Intronic
1137235083 16:46609919-46609941 TGGTGGGGGAGGAGAGCAGAGGG - Intronic
1137571408 16:49568606-49568628 CTGTGGGGCAGGAGAGCAGGCGG - Intronic
1137581181 16:49634522-49634544 GAGGGGGTGAGGAGGGCAGAGGG - Intronic
1137612345 16:49827180-49827202 AAGTGGGTGATGAGGTCAGATGG - Intronic
1138448204 16:57077848-57077870 CTGCGGGAGAGGAGGCCAGGTGG - Intronic
1139486963 16:67263253-67263275 AGGTAGATGAGGAGGGCAGATGG + Intronic
1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG + Intronic
1139599783 16:67979766-67979788 CTGGGGGTGTGAAGGTCAGATGG + Intronic
1139709308 16:68763627-68763649 AAGTGGGGGAGGAGGGCCGAGGG - Intronic
1140134928 16:72197601-72197623 CAGTGGAGGAGGAGGGCAGCCGG - Intergenic
1141244264 16:82291642-82291664 GGGAGGGTGAGGCGGGCAGATGG - Intergenic
1141749709 16:85950138-85950160 CTGTGGGTGAGGGAGGAAGTAGG + Intergenic
1141760583 16:86026240-86026262 CAGTGGGGGAGGCAGGCAGAGGG + Intergenic
1141844887 16:86601547-86601569 CTGGGGCTGAGCAGGGCAGGAGG + Intergenic
1141882337 16:86868269-86868291 GTGAGGGTGAGGTGGGCGGAGGG + Intergenic
1141956594 16:87376079-87376101 CTGTGGCAGTGGAGGGCAGGGGG - Intronic
1142124541 16:88403632-88403654 CTGTGGGGGCCGAGGGCAGGAGG - Intergenic
1142356039 16:89602515-89602537 CGGTGGGTGGGGGGGGCAGCTGG + Intergenic
1142621300 17:1167213-1167235 CTGGGTGTTAGGAGGGCAGAAGG - Intronic
1142809577 17:2389046-2389068 CTGTGTGTGATGAGGGCAGACGG - Intronic
1143092236 17:4455706-4455728 CTGTGGGTGGGGATGCCAGATGG - Intronic
1143136826 17:4716796-4716818 CTGGGGATGAGAAGGGAAGAAGG - Intronic
1143203730 17:5129337-5129359 CTGTGGGTGGGGAGGAGGGAAGG + Intronic
1143575782 17:7792357-7792379 CTGGGTGTGAGGAGGGCATGGGG + Intronic
1143984074 17:10895958-10895980 CTGGGGGTAGGGAGGGCATAGGG + Intergenic
1144630853 17:16871683-16871705 CTGTGGGTGAGGGCGTCAGTTGG + Intergenic
1144685440 17:17223059-17223081 CTGTGCTTCTGGAGGGCAGAAGG + Intronic
1144874910 17:18392448-18392470 CTGTGGGTGGGGAGGAGGGAAGG + Intergenic
1144889622 17:18487087-18487109 GGGAGGGTGAGGAGGACAGATGG + Intronic
1145043892 17:19597057-19597079 GTGTGAGTTGGGAGGGCAGAAGG + Intergenic
1145142589 17:20457209-20457231 GGGAGGGTGAGGAGGACAGATGG - Intronic
1145157315 17:20551973-20551995 CTGTGGGTGGGGAGGAGGGAAGG - Intergenic
1145878872 17:28339747-28339769 CTCGGGGTGGGGAGGGCAGGAGG + Intronic
1145980148 17:29006204-29006226 CTGGGGGTGGGCAGCGCAGAAGG - Exonic
1146671827 17:34743133-34743155 CTGTGGGTTAGGAGGGGTGGAGG - Intergenic
1146931145 17:36778805-36778827 CTGTGCTGGAGGAGGGCAGCTGG - Intergenic
1147167683 17:38602138-38602160 TTCTGGGGGAGGTGGGCAGAGGG - Intronic
1147357065 17:39906469-39906491 CTGGGGGTGAGCTGGGGAGATGG - Intronic
1148050944 17:44769695-44769717 CTGGGTGGGGGGAGGGCAGAGGG - Intronic
1148235181 17:45964002-45964024 CTCTGGGTGAGGAGGTGAGAGGG + Intronic
1148492763 17:48033766-48033788 CTGTGGGTGTGCAAGGCTGATGG + Intronic
1148721561 17:49757181-49757203 CTGGGGGGGTGGAGGACAGATGG - Intronic
1148807708 17:50272551-50272573 CTGCAGGGGAGGAGGGGAGACGG + Intronic
1148848214 17:50541328-50541350 CTGTGGGTGAGCAGGGCAAGGGG + Exonic
1149261285 17:54882549-54882571 GGGAGGCTGAGGAGGGCAGATGG + Intergenic
1149432510 17:56605636-56605658 CTGAGGGCGAGGATGGAAGATGG - Intergenic
1149516500 17:57284867-57284889 TTCTGGTTGAGGAGGGCATAGGG - Intronic
1149606727 17:57930351-57930373 CTGGCTGTGAGGAGGCCAGAAGG + Intronic
1150007736 17:61479985-61480007 CTGGGGGTGGGGCGGGCAGATGG + Intronic
1150128526 17:62653734-62653756 CTGTTGGGGAGGAGGGAGGAGGG + Intronic
1150207345 17:63419101-63419123 CTGGGGAGGAGGAGGGCAGGAGG - Intronic
1150810564 17:68353590-68353612 CGGTGGGTAAGAAGGGCAGCAGG - Intronic
1150993017 17:70282684-70282706 TTGGGGGTGAGAATGGCAGAGGG + Intergenic
1151327812 17:73389706-73389728 CTGTGAGTGGGGAGGGGAGAGGG + Intronic
1151354394 17:73549957-73549979 CTGTGGGTGAGGACCGCCGGGGG + Intronic
1151724355 17:75875845-75875867 CTGTGCGAGAGGCTGGCAGAGGG + Intronic
1151740945 17:75981615-75981637 CTGAGGGAGAGGAGGACAGAAGG - Intronic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152255574 17:79237498-79237520 CTGTGGGTGAGACAGGCAGATGG - Intronic
1152355627 17:79805769-79805791 CTGTGGGTGAGATGGGTAGGGGG + Intergenic
1152562718 17:81086635-81086657 CTGTGGACGAGGGGGGCCGAGGG - Intronic
1152577989 17:81151315-81151337 ATGTGGGGGAGGAGGGGTGAGGG - Intronic
1152593955 17:81229245-81229267 CTGGGGGTGGGGTGGGCACAGGG + Exonic
1152686483 17:81696208-81696230 CTCTGGGGGAGGCAGGCAGAGGG - Intronic
1152911883 17:83009935-83009957 CTGTGGGGGAGGGGGGCTGTGGG + Intronic
1153168001 18:2283898-2283920 CTTTGGGCGAGGAAGGGAGAAGG - Intergenic
1154308915 18:13252780-13252802 CTGTGGATGTGGAGGGCCGACGG - Intronic
1154437854 18:14360691-14360713 CTCTGGGGGCGGAGAGCAGAGGG - Intergenic
1154500170 18:14992097-14992119 CTGTGGGCTGGGAGGGCAGCTGG + Intergenic
1154501753 18:15000916-15000938 CTGGGGGTGGGCAGGGCGGAGGG + Intergenic
1155241429 18:23867137-23867159 AGGAGGGTGGGGAGGGCAGAGGG - Intronic
1156310561 18:35918489-35918511 CTGGGGGTCAGGAGTGCAGAGGG + Intergenic
1156454717 18:37286549-37286571 CTGTGGGTCAGAGGGGCAGGGGG - Intronic
1156500414 18:37554061-37554083 TTGTGGCTGAGGAGGGGAGAGGG + Intronic
1157446701 18:47751624-47751646 GTGTGGATGAGGAGGGGACAAGG + Intergenic
1157752587 18:50193272-50193294 CTCTGGGGGAGGAGGGGAGGAGG - Intronic
1158452758 18:57581521-57581543 CTTAGGAGGAGGAGGGCAGAAGG - Intronic
1158519759 18:58162144-58162166 CTGTGAGGGAACAGGGCAGAAGG - Intronic
1158884666 18:61815839-61815861 CTGTGGCTGAAGAGGGCTGCAGG - Exonic
1159548675 18:69872109-69872131 CTGAAGGAGAGGAGTGCAGATGG + Intronic
1159590763 18:70332721-70332743 TTGGGGGTGGGGAGGGTAGAGGG - Intergenic
1160235129 18:77079351-77079373 CTGTGGGGGAGCAGGGCTTAGGG + Intronic
1160242650 18:77133952-77133974 CTGAAGGTGAGGAGGGAAAAGGG + Intergenic
1160385290 18:78493056-78493078 CTGTGGCTGAGGAGGGCACGGGG + Intergenic
1160684236 19:426215-426237 TGCTGGGTGACGAGGGCAGAGGG + Intronic
1160719876 19:592364-592386 CTGGGGGGCAGGTGGGCAGATGG + Intronic
1160745742 19:709996-710018 CTGTGGGAGTGAGGGGCAGAGGG - Intronic
1160983468 19:1827149-1827171 CTGAGGCTGGGGAGGGCAGAGGG + Exonic
1161028275 19:2046572-2046594 CCGAGGGGGAGGAGGGCACAGGG - Intronic
1161161052 19:2762119-2762141 CTGGGGGTGAGTGGGGCAGGTGG - Intronic
1161186765 19:2926598-2926620 CTGTGGGTGTGGGGGACCGAGGG - Intergenic
1161241666 19:3226506-3226528 ATGTGGCCTAGGAGGGCAGAGGG + Intronic
1161421959 19:4180910-4180932 CTGTGGGGGGAGAGAGCAGACGG + Intronic
1161498155 19:4598479-4598501 CTGGCGGTGGGGAGGTCAGAGGG - Intergenic
1161851792 19:6740974-6740996 TGGTGGGGGAGGAGGGGAGAGGG - Intronic
1162068234 19:8138363-8138385 CTGTGGGTGAGGAGGGGACAGGG - Intronic
1162799067 19:13101151-13101173 CTGTGCCTGAGGCGGGCACATGG + Exonic
1162830011 19:13278544-13278566 CCGGGGGTGTGGTGGGCAGAGGG - Intronic
1162885265 19:13692373-13692395 CTGTGACTCAGGAGGGCAGGTGG + Intergenic
1162958242 19:14111810-14111832 CAGTGGGTGGGGAGGGTGGAGGG + Intronic
1163278323 19:16299888-16299910 TTTTTGGTGGGGAGGGCAGAGGG - Intergenic
1163430479 19:17264213-17264235 ATCTGGGTGTGGAGGGGAGAGGG + Intronic
1164378610 19:27711737-27711759 CTGTGGGAGAGGAAGGCTGAGGG + Intergenic
1164623695 19:29713201-29713223 AAGTGGGTGAGGAGGGAGGATGG + Intronic
1164772938 19:30826102-30826124 CTGTAAGTGAGAAGGGTAGAGGG + Intergenic
1165258701 19:34595822-34595844 CTGGGGGTGGGGAAGGCAGCAGG + Exonic
1165258777 19:34596246-34596268 CTGTGGCTGAGCAGGGAGGATGG + Exonic
1166214278 19:41325431-41325453 CGGTGAGGGAGGAAGGCAGAGGG - Intronic
1166803492 19:45471728-45471750 CTGTGGGTGGCTAGGGCAGGAGG - Intronic
1166893806 19:46010557-46010579 CTGTGGGAGAGGGAGGCAGGAGG + Intronic
1166960066 19:46491929-46491951 CTGTGGGTGGGGAGGGCCCCAGG - Exonic
1167031967 19:46968363-46968385 CTGTGGGTCAGCAGAGCAGGAGG + Intronic
1167097105 19:47380396-47380418 ATGTGGGTGGGGTGGGGAGAAGG + Intronic
1167099341 19:47394407-47394429 CTGGGTGTGAGGACGACAGAAGG - Intergenic
1167267308 19:48489989-48490011 CTCTGGGAGAGCAGGGCACACGG - Intronic
1167437763 19:49489827-49489849 CTGTGGGAGACAAGGGCAAAAGG - Intronic
1167449136 19:49556802-49556824 CTGTGCGTGAGGAGGACGGTGGG + Intronic
1168132731 19:54331673-54331695 CTGTGGGAGAGGAGACCACAGGG + Intergenic
1168135317 19:54347131-54347153 ACGTGGGTGAGGAGGGCTCAAGG + Intergenic
1168153331 19:54460548-54460570 GTGAGGGTGAGGGGGGCACAGGG + Intronic
1168241573 19:55091620-55091642 CTGTGGGGGCTGTGGGCAGAGGG - Intronic
1202665026 1_KI270708v1_random:110558-110580 ATGTGTGTCAGGTGGGCAGAGGG - Intergenic
1202665039 1_KI270708v1_random:110678-110700 ATTTGTGTCAGGAGGGCAGAGGG - Intergenic
925082165 2:1078843-1078865 CTGAGGGTCAGGAGGGAGGAAGG + Intronic
926153331 2:10436456-10436478 CTGGGGGTGAGGGGGGCAAGTGG - Intergenic
926197600 2:10773139-10773161 CTGTGTGTCAGGAGGGATGAAGG + Intronic
926452516 2:13023212-13023234 CTATAGTTGAGGATGGCAGAAGG + Intergenic
927186088 2:20483687-20483709 CTGTGGCTGAGGCTGGCTGAGGG - Intergenic
927190869 2:20516073-20516095 CAGTGTGGGAGCAGGGCAGAGGG + Intergenic
927635681 2:24814603-24814625 GTGTGAGTGATGAGGGCAGAGGG - Intronic
927885875 2:26718181-26718203 CTGTGGGAGATGGGGGCAGGTGG - Intronic
927928152 2:27027110-27027132 CAGGGGGTGGGGAGGGCAGGTGG - Exonic
927964418 2:27260299-27260321 CTATGGCTGAGGATGGCAGTGGG + Intronic
928121391 2:28586305-28586327 CTATAGGAGCGGAGGGCAGAGGG - Intronic
928615435 2:33034001-33034023 CTGGGGGACAGGAGAGCAGATGG + Intronic
928771512 2:34707435-34707457 CTGTAGAAGAGAAGGGCAGAAGG + Intergenic
928796796 2:35033161-35033183 CAGTGGGTAAGAGGGGCAGAGGG + Intergenic
929067749 2:37996951-37996973 CTCTGGGTCAGGAGGCCAGTTGG + Intronic
929467666 2:42159763-42159785 CTATGGATGTGTAGGGCAGAGGG - Intergenic
929918683 2:46156856-46156878 GTGTGTGGGAGGTGGGCAGATGG - Intronic
929920378 2:46167395-46167417 CTGTTGGTGAGGAGGACAACAGG + Intronic
929947511 2:46381952-46381974 CTGGGAGTAAGAAGGGCAGATGG - Intronic
929949111 2:46392923-46392945 CTGGAGGTGAGGAGGGGTGAAGG + Intergenic
930028979 2:47046959-47046981 CCGTGGGTGACTAGGGAAGAAGG - Intronic
930057834 2:47265519-47265541 GTGTGGAGGAGGAGGGGAGAGGG - Intergenic
931396000 2:61888771-61888793 CTGTGGGTGAAGAGCGCCGGGGG + Exonic
932701330 2:73993979-73994001 CTGTGGGTGTGGTGGGTAGGTGG + Intronic
932772009 2:74505720-74505742 CTGCAGGTGAGAAGGGCTGAGGG - Exonic
933166924 2:79086791-79086813 ATGTGAGTGAGGAGAGCAGCAGG - Exonic
933721860 2:85402037-85402059 CTGGGGATGAGGAGAGCAGTGGG + Intronic
933834976 2:86238690-86238712 CTGTGGGTGCACAGGGCAGAAGG + Intronic
933854482 2:86400027-86400049 CTGAGGGTGTGGGGGGCAGCAGG + Intergenic
934300672 2:91774381-91774403 CTGTGTGTGGGGAGGGCACAGGG + Intergenic
934536693 2:95140128-95140150 CAGTGGGTGAGGGGAGCTGAGGG + Intronic
934695907 2:96400012-96400034 CTGTTGCTGAGGAGGGAAGAGGG - Intergenic
934712967 2:96527656-96527678 CTGGGGGTGGGGAGGGGGGAGGG - Intergenic
934745428 2:96756486-96756508 GTGTGGATGATGAGGGAAGAAGG - Intergenic
934858708 2:97745702-97745724 CTGTGGGTGGGGATGTGAGATGG + Intergenic
934861564 2:97767822-97767844 CTGTGGGCTGGGAGGACAGAAGG - Intronic
934930587 2:98419337-98419359 CCTTGGGTGTGGAGGGAAGAGGG - Intergenic
935050229 2:99518966-99518988 CTGGGGGTGAGGTGGGGAGTGGG - Intergenic
935101326 2:99998482-99998504 ATGGGGGAGAGGTGGGCAGAGGG + Intronic
935328973 2:101962387-101962409 CGGAGGGCGAGGAGGGCACAGGG + Intergenic
935580618 2:104753067-104753089 CTGTGGCTGGGAAGGGTAGAGGG + Intergenic
935645303 2:105329604-105329626 CGGTGAGTGAGGAGGGCGGCGGG - Exonic
936519857 2:113204858-113204880 GTCGGGGTGAGGGGGGCAGAGGG + Intronic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
936937357 2:117851207-117851229 CAGTGGGTGAGGAAGAAAGATGG + Intergenic
937015723 2:118603498-118603520 GTGTGTGTGTTGAGGGCAGAGGG + Intergenic
937197682 2:120174214-120174236 GGGAGGCTGAGGAGGGCAGATGG + Intronic
937257241 2:120564275-120564297 CTGGGGGCGAGGCGGGCAGAGGG + Intergenic
937267423 2:120625283-120625305 GTGCAGCTGAGGAGGGCAGAGGG + Intergenic
937345216 2:121121163-121121185 CTGTGGAAGGGGAGGGCAGGGGG + Intergenic
937982098 2:127621958-127621980 TGGTGGGTGAGGAGGGGAGAAGG - Intronic
937985715 2:127637266-127637288 CTGTGGGTGCAGAGGGCAGGTGG - Intronic
938235049 2:129699161-129699183 TTGTGGGAGGGGAGGGCAAAGGG + Intergenic
938310286 2:130285012-130285034 CTGAGGGGCAGGAAGGCAGAGGG - Intergenic
938499383 2:131822456-131822478 CTGTGGGCTGGGAGGGCAGCTGG + Intergenic
938739844 2:134220701-134220723 AGGAGGGTGAGGAGGGGAGAAGG - Intronic
939925810 2:148172466-148172488 CTGGGGTTGGGGAAGGCAGAGGG + Intronic
940310015 2:152268635-152268657 GGGAGGCTGAGGAGGGCAGATGG - Intergenic
940683032 2:156810036-156810058 CTGTGGATAAGGAGGACATACGG - Intergenic
940855067 2:158723309-158723331 CTGTGGGGGTGGAGGACAAATGG - Intergenic
940877658 2:158914200-158914222 TTGTGGCTGAGAAGGGGAGAAGG + Intergenic
941003232 2:160222524-160222546 ATGTGGGTGAGGAAGGGGGATGG - Intronic
941451006 2:165660120-165660142 CCGTGGGTGACAAAGGCAGAGGG - Intronic
941622088 2:167789770-167789792 CTGTGGGGGAGGAGGAAAGGTGG - Intergenic
941720031 2:168802701-168802723 CTGCGTGTGAGGAGGGTGGAGGG + Intronic
942506302 2:176645030-176645052 CTGTGGTTGGGGAGGCCAGTTGG + Intergenic
942611518 2:177746789-177746811 CTGAGGGTGAGAGGGGAAGAGGG + Intronic
945233912 2:207616881-207616903 CTGTGGCTGAGTGGGGCTGAAGG - Intronic
946022868 2:216653637-216653659 CTGGAGATGAGGAAGGCAGATGG - Intronic
946051613 2:216867508-216867530 ATGTATGTGAGGAGGGGAGAGGG - Intergenic
946741902 2:222810705-222810727 GTGTGGGTGAAGGGGGCATATGG + Intergenic
946784217 2:223225437-223225459 CTGTGAGTGAGATGGTCAGATGG + Intergenic
947103256 2:226644149-226644171 CTGTGGGAGAGAAAGGGAGAGGG - Intergenic
947126900 2:226878719-226878741 CTGTGGGTCAGGAATTCAGAAGG - Intronic
947231533 2:227892623-227892645 CTGTGGGAGAAGATGGTAGAAGG + Intronic
947727222 2:232408198-232408220 CTGTGCATGAGGAGGGGACACGG + Intronic
947878094 2:233480915-233480937 CTGCGGGTGAGGAGGAAGGAGGG + Intronic
947926384 2:233925831-233925853 CTTTGGGAGACGAGGGGAGAGGG + Intronic
948326917 2:237131860-237131882 CTGAGGGTGGGGAGGGGAGCAGG - Intergenic
948846904 2:240687610-240687632 CTGTGGGTGGGGGGTGCACACGG + Intergenic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1168770077 20:408891-408913 CTGATGGGGAGGAGGGTAGAGGG - Intronic
1169066163 20:2695213-2695235 GAGTGGGTGAGGAGTGCTGATGG + Intronic
1169066425 20:2696685-2696707 GTGCGGGTGCTGAGGGCAGAGGG - Intronic
1169104635 20:2984220-2984242 ATGTGAGTGAGGTGGACAGATGG - Intronic
1169234802 20:3922425-3922447 CTGTGTCTCAGGAGGGCTGAGGG + Intronic
1169355502 20:4901620-4901642 CAGTGGGAGGGGAGGGCAGCCGG - Intronic
1169967313 20:11232305-11232327 CTGAGGGTGGGGAGTTCAGATGG - Intergenic
1170645238 20:18191740-18191762 CTGGGGGTGAGGTGGGGAGAGGG + Intergenic
1170827862 20:19811521-19811543 CAGTGGGTGTGGAGGGGACAAGG + Intergenic
1170857867 20:20074092-20074114 TTGTGAGTAAGGAGGACAGAAGG + Intronic
1171022879 20:21602698-21602720 CTGTGGGTAGGGAGGGCTGGAGG + Intergenic
1171042278 20:21776557-21776579 GTGTGGGTCTGGAAGGCAGAAGG + Intergenic
1171411769 20:24952642-24952664 CTCTGGGTGATGGGGGCCGATGG + Intronic
1171422249 20:25025051-25025073 CTATGGGCGAGGAAGGGAGATGG + Intronic
1171794828 20:29558677-29558699 CTGGGGGTGAGGATGTCAAACGG - Intergenic
1171853628 20:30325588-30325610 CTGGGGGTGAGGATGTCAAACGG + Intergenic
1172641650 20:36443736-36443758 CTGTCGGTGGGGAGGCCAGCTGG - Intronic
1172766751 20:37355224-37355246 GTGGGGGTGGGGAGGGCAGGAGG - Intronic
1172975960 20:38906114-38906136 CTGTGGGGGAGGCCGGCACAGGG + Intronic
1173342058 20:42161616-42161638 CTTGGCCTGAGGAGGGCAGAGGG + Intronic
1173399291 20:42710375-42710397 CTGAGGCTGGGCAGGGCAGAAGG - Intronic
1173422916 20:42918552-42918574 GCGTGGGTGAGGAGAGCAGGTGG - Intronic
1173438485 20:43054312-43054334 CGGAGGCTGAGGTGGGCAGATGG + Intronic
1173528254 20:43749370-43749392 CTGGGGGAGAGGAGGGGACATGG - Intergenic
1174036677 20:47672813-47672835 CTGAGGGAGAGGAGGACCGATGG - Intronic
1174087493 20:48019531-48019553 CTGAGGTTGAGGAGGGAAGAGGG + Intergenic
1174103101 20:48142201-48142223 CTGTGTATGAGGAGGGAGGAGGG - Intergenic
1174196558 20:48776430-48776452 CTGTGGGAGGGGATGGCAGCTGG + Intronic
1174389632 20:50210195-50210217 CTGTGGGAGAGTAAGGCAGGAGG - Intergenic
1174526390 20:51175317-51175339 TTGTGGGTGATGAGGGCTGCAGG + Intergenic
1174882175 20:54292014-54292036 CTGTGGGTTAGGTGGGGAGAGGG - Intergenic
1175010514 20:55729830-55729852 TTGTGGGTGAGGAGGAGACAAGG + Intergenic
1175518961 20:59587558-59587580 CTGTGGGTCAGGGGTGCAGGTGG + Intronic
1175581889 20:60106219-60106241 CTGTGGGAGAGCAAGGCAGGAGG - Intergenic
1175660041 20:60804522-60804544 TTGTGGGTCAGGAAGGAAGAGGG + Intergenic
1176169664 20:63691116-63691138 CTGTGGGTGAGGTGGGGTGGAGG - Intronic
1176184155 20:63769084-63769106 GGGTGGGAGAGGAGGGCACATGG + Intronic
1176304476 21:5115965-5115987 CAGTGGGTGGGGAGGGCCGAGGG + Intergenic
1176385786 21:6138038-6138060 CTGTGGATGCGTAGGCCAGAGGG - Intergenic
1177204383 21:17994736-17994758 GTGTGGGTGCCGATGGCAGAAGG + Intronic
1177276023 21:18913791-18913813 CTCTGGATGAGGAGAGAAGAGGG - Intergenic
1178232798 21:30806155-30806177 CGATGGGTGAGGAGGAAAGAAGG + Intergenic
1178477540 21:32950479-32950501 CATTGGGTGGGGCGGGCAGAGGG + Intergenic
1178769239 21:35487249-35487271 GAGTGGGTAGGGAGGGCAGAAGG + Intronic
1179025288 21:37674495-37674517 CAGTGGGTGAGGAGGGGAGTGGG - Intronic
1179291326 21:40020701-40020723 AGGTAGGTGAGCAGGGCAGAAGG - Intronic
1179343894 21:40538186-40538208 CTCTGAGTGGAGAGGGCAGAAGG - Intronic
1179385457 21:40937668-40937690 CTGGGGCAGAGGAGGGTAGAGGG - Intergenic
1179437682 21:41373576-41373598 CTGTGGGGCTGAAGGGCAGAGGG - Intronic
1179543715 21:42100791-42100813 GGGAGGGTGAGGAGGGCACAGGG - Intronic
1179562958 21:42228380-42228402 CTGTGGCTGGGGAGGGCAGTGGG - Intronic
1179737687 21:43400214-43400236 CTGTGGATGCGTAGGCCAGAGGG + Intergenic
1179792658 21:43764478-43764500 GTGGGGGTGGGGACGGCAGATGG + Intergenic
1179837719 21:44048322-44048344 CAGAGGGTGGGGAGGGCAGGGGG - Intronic
1179852580 21:44146065-44146087 CAGTGGGTGGGGAGGGCCGAGGG - Intergenic
1179996695 21:44977510-44977532 CTCTGGGGGCGGAGAGCAGAGGG + Intergenic
1180044993 21:45301210-45301232 CTGTGGCTGAGCAGTGCTGAAGG - Intergenic
1180057172 21:45364998-45365020 CTGTGGGCGGGAAGAGCAGATGG + Intergenic
1180331752 22:11487478-11487500 ATGTGTGTCAGGTGGGCAGAGGG - Intergenic
1180331765 22:11487598-11487620 ATTTGTGTCAGGAGGGCAGAGGG - Intergenic
1180700722 22:17780246-17780268 CTGTGCATCTGGAGGGCAGAGGG + Intergenic
1180709944 22:17832730-17832752 CTGTGGGTGTGGTGGGGGGAGGG + Intronic
1180816487 22:18792756-18792778 CTGTGTGTGGGGAGGGCACGGGG - Intergenic
1180868465 22:19133118-19133140 CACTGGGTGGGGAGGGCACACGG - Exonic
1181151160 22:20884437-20884459 CTGCAGGTGATGAGGGCAGAAGG - Intronic
1181202674 22:21227088-21227110 CTGTGTGTGGGGAGGGCACGGGG - Intronic
1181308509 22:21930809-21930831 CTGTGGGTGAGGAAGGCCTCAGG - Intronic
1181462398 22:23093523-23093545 CTATGGAGGAGGAGGACAGAGGG + Intronic
1181636692 22:24177914-24177936 GTGTGGGTGAGGATGGCATAGGG + Intronic
1181699027 22:24609517-24609539 CTGTGTGTGGGGAGGGCACAGGG + Intronic
1181783163 22:25207406-25207428 CTGTGGGAGAGGCGTGCTGAAGG + Intergenic
1182146572 22:28000457-28000479 CTGTGGGGTATTAGGGCAGATGG + Intronic
1182253165 22:29018071-29018093 GTGTGGGAGGGGAGGGCGGACGG + Intronic
1182355255 22:29719932-29719954 CTGGGGGTGGGGAGCGCGGAGGG + Intergenic
1182517120 22:30865198-30865220 CTCTGGCTGAGGAGGCCACAGGG - Intronic
1182550923 22:31100373-31100395 CTGAGGGTGAGGTGAGCAGACGG - Intronic
1182556979 22:31134416-31134438 CTGAGGGTGGGGTAGGCAGATGG + Exonic
1182973479 22:34599772-34599794 CTGTGTCTGAGGAGTGGAGAGGG - Intergenic
1182977637 22:34638226-34638248 CTGTAGGTGGGGAGTGCAGAGGG - Intergenic
1182985046 22:34708283-34708305 CAGTGGGAGAGGAGCACAGAAGG - Intergenic
1183225702 22:36548615-36548637 CTGGGGGTGAGGTGATCAGATGG + Intergenic
1183261288 22:36797523-36797545 CTCTGGGTGGAGAGGGGAGAGGG + Intergenic
1183291084 22:37002388-37002410 ATGGGGGTGAGGAGGGGAAACGG + Intronic
1183302286 22:37064243-37064265 CTGTGGGTGAATGAGGCAGAAGG - Intergenic
1183339362 22:37271072-37271094 ATGGGGGTGAGGAGGGTAGAGGG + Intergenic
1183581535 22:38729370-38729392 CTGTGGGAGAAGGGGGCTGAGGG + Intronic
1183666548 22:39249428-39249450 GTGAGGGTGAGGCAGGCAGAGGG - Intergenic
1184162350 22:42704541-42704563 CTGTTTGTAAGAAGGGCAGAAGG + Intronic
1184268003 22:43360301-43360323 CTGTGGGTGGGGAGTGAAGCGGG + Intergenic
1184275042 22:43405227-43405249 CTGAGGGTGGGGAGGGCCGGAGG + Intergenic
1184341768 22:43890074-43890096 CTGTGGGTGTGCAGGGAAGGAGG + Intronic
1184352814 22:43955632-43955654 CTCTGGGCCAGCAGGGCAGACGG + Intronic
1184410442 22:44323106-44323128 GGGTGGGTGAGGTGGGTAGATGG - Intergenic
1184410533 22:44323519-44323541 GGGTGGGTGAGGTGGGTAGATGG - Intergenic
1184617646 22:45648780-45648802 CTGCGGATGAGCAGGGCGGAAGG - Intergenic
1185295377 22:50050548-50050570 AGGTGGGGGAGGAGGGCAGCAGG - Intronic
1185363261 22:50422231-50422253 CTGTGGATGAGGAAAGCAGATGG - Intronic
1203224239 22_KI270731v1_random:68325-68347 CTGTGTGTGGGGAGGGCACGGGG + Intergenic
1203266587 22_KI270734v1_random:18467-18489 CTGTGTGTGGGGAGGGCACGGGG - Intergenic
949891627 3:8737647-8737669 GTGTTGGTGAGGAGGGCAAGTGG - Intronic
950043388 3:9934059-9934081 CTGAAGGAGAGGAGGCCAGAGGG - Intronic
950141815 3:10620924-10620946 CTGTGAGTGAGGAGGACACAGGG - Intronic
950340923 3:12243674-12243696 CTGGGGGTTAGGAGGGCTGTAGG + Intergenic
950421428 3:12901879-12901901 CTGTGTGTGGCGAGTGCAGAGGG + Intronic
950833720 3:15900036-15900058 CAGTGGCTGAGGTGGGAAGATGG - Intergenic
950965674 3:17144138-17144160 CAGGGGCTGAGGAGGGAAGAAGG - Intergenic
950967965 3:17159538-17159560 GAGTGGGTGAGGATGGCAGAGGG - Intronic
951026620 3:17837873-17837895 ATGTGGGTAAAGAGGGCTGAAGG + Intronic
952049700 3:29369539-29369561 GTGAGGGTGAGGAGGAGAGAGGG + Intronic
952337943 3:32421054-32421076 GGGTGGGAGAGGAGGGCAGCAGG - Intronic
953031065 3:39180351-39180373 ATGTGGGTGAGGAGGAGAGTGGG + Intergenic
953972699 3:47359518-47359540 CTGAGGGTGTGCAGGGCAGCAGG - Intergenic
953983358 3:47423904-47423926 CAGTGGGAGAGTTGGGCAGAGGG - Intronic
954049358 3:47960384-47960406 CTGTTGATGAGGAAGACAGAGGG - Intronic
954412997 3:50379282-50379304 CTGTGGGGGAGGAGGGCCAGAGG - Intronic
954487181 3:50863405-50863427 CTCTGGGTTACAAGGGCAGAGGG + Intronic
954609249 3:51935571-51935593 CTGTGAGTGTGGATGGGAGAGGG - Exonic
954782793 3:53073298-53073320 CTGTGGGTGAGGAGAGAACCTGG + Intronic
955235247 3:57133619-57133641 TTGTGGGTGAAGAAGGCAGTGGG + Intronic
956096243 3:65719788-65719810 CTTTGGGAGAGCAAGGCAGATGG - Intronic
956452403 3:69387237-69387259 CCGTGGCTGAGGTGGGAAGATGG - Intronic
956746998 3:72318216-72318238 GGGAGGCTGAGGAGGGCAGATGG + Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957106153 3:75890188-75890210 CTGAGGGTCAGGAGTGTAGATGG - Intergenic
958735650 3:98006769-98006791 TGGAGGGTGAGGAGGGCAGAGGG + Intronic
958862236 3:99457985-99458007 CTGTGGGTGAGGAGGTTTGCAGG + Intergenic
959156643 3:102674497-102674519 CAGTGGCTGGGGCGGGCAGAAGG - Intergenic
959594988 3:108119986-108120008 AGGTGGCTGAGGTGGGCAGATGG + Intergenic
959946704 3:112133054-112133076 CTGTGGGAGAGCAGAGGAGATGG - Intronic
960597073 3:119416003-119416025 CTGTGGATGAAGGGGGCAGGTGG - Exonic
960697490 3:120410318-120410340 CTGTGGGTGAAAAGGGCACTGGG + Intronic
961624853 3:128254771-128254793 CTGAGAGTGGGGAGGGGAGAGGG + Intronic
961746095 3:129064312-129064334 CTGTGGGTGGAGAGGGTGGAGGG + Intergenic
962108505 3:132417663-132417685 GTGAGGGTGAGGAGGCCGGAGGG + Exonic
962278640 3:134033837-134033859 CAGTGGGTGATGTGGGCAGGAGG + Intronic
963229704 3:142896594-142896616 CAGTGAGTGAGGAGAGCACAGGG - Intergenic
963908179 3:150791503-150791525 CTCTGTGTGTGGAGGGCACATGG - Intergenic
964542646 3:157796718-157796740 CTGTGGGTGAGTATGGTGGAAGG - Intergenic
965475028 3:169146588-169146610 CTGCGGGCGAGGAGGAAAGAAGG + Intronic
965774249 3:172211594-172211616 CTGTAGAAGAGGAGGGCTGATGG + Intronic
966234219 3:177682823-177682845 TTGGGGGTGGGGAAGGCAGAAGG - Intergenic
966839529 3:184077375-184077397 GTGTGGGTGAGGTGGGTAGAAGG + Intergenic
967844886 3:194035538-194035560 TTGTGTGGGAGGAGGGCAGTGGG - Intergenic
967948271 3:194821035-194821057 CTGTGGTTGAGGGAAGCAGAGGG + Intergenic
968052221 3:195662975-195662997 GGGTGGGTGGGGAGGGTAGATGG - Intergenic
968085594 3:195872599-195872621 CTGTTGGGGAGGAGGGCCGGTGG - Intronic
968103589 3:195985363-195985385 GGGTGGGTGGGGAGGGTAGATGG + Intergenic
968301891 3:197622956-197622978 GGGTGGGTGGGGAGGGTAGATGG + Intergenic
968579077 4:1381367-1381389 GTATGGCTGAGGAGGCCAGAGGG - Intronic
968768073 4:2485049-2485071 ATGTGGGTGGGGTGGGCGGAAGG - Intronic
968909310 4:3469480-3469502 GGGTGGGTGAGCAGGGCCGATGG + Intronic
968948487 4:3678050-3678072 CTGAGGGTGAGGAGGAGAGGAGG + Intergenic
969226956 4:5804957-5804979 CAGCGGGTGAGGAAGGCCGATGG - Intronic
969311038 4:6353403-6353425 CTGTCGGTGTGGAGGGCTGTCGG - Intronic
969423057 4:7108412-7108434 ATGTCGGGGAGGAGGGCAGGGGG - Intergenic
969682241 4:8649781-8649803 CTGTGGGGCAGGCGGGCAGCGGG - Intergenic
972397809 4:38672583-38672605 CTGGGGGTGGGCAGGGCAGCCGG + Intronic
972629328 4:40829673-40829695 CCATGGGTGTGTAGGGCAGAGGG + Intronic
973561723 4:52143859-52143881 GTGTGGGTGAGAAGGGGAGGTGG - Intergenic
974194184 4:58550210-58550232 CTGTGTGTGAGTAGGGCATGAGG + Intergenic
974331133 4:60480688-60480710 TTGTGGGGGAGGAGGGGGGAGGG - Intergenic
974887106 4:67833302-67833324 CTGAGGCTGAGGAGGGAAGCTGG - Exonic
975299110 4:72768448-72768470 CTGTCGGTGAGCATGGAAGAGGG - Intergenic
975369548 4:73568640-73568662 TTGTGCTTGAGGAGGGAAGAAGG - Intergenic
975572057 4:75827902-75827924 CTGAGAGACAGGAGGGCAGAAGG - Intergenic
975878593 4:78873934-78873956 CTTTGGGTGACCAGGGCAGGCGG + Intronic
977938814 4:102835879-102835901 CTGTGGGTTAAGAAGACAGAGGG - Intronic
978749201 4:112228139-112228161 CGGAGGCTGAGGTGGGCAGATGG - Intergenic
978777045 4:112515251-112515273 CTGCGGGTGCGGAGGGCTGCCGG - Exonic
979306855 4:119155580-119155602 GTGGGGCTGAGGAGGGCAGAGGG + Intronic
980099515 4:128527672-128527694 CTGTGCGTGGAGAGAGCAGAGGG + Intergenic
980415427 4:132482755-132482777 CTGTGGTTGGAGAGAGCAGATGG + Intergenic
980473009 4:133273942-133273964 TTGTGGGTGGGGTGGGGAGAGGG - Intergenic
981016012 4:139975200-139975222 GTGTGGGAGAGGAGGACATAAGG - Intronic
981466091 4:145074306-145074328 CTCTTTTTGAGGAGGGCAGAGGG + Intronic
981514091 4:145588198-145588220 CTGTGGGTGAAGTGGGCAAGAGG + Intergenic
981702499 4:147622180-147622202 GTGAGGCTGAGGAGGGCAGATGG - Intronic
982316331 4:154035801-154035823 CTGTCGGGGAGGAGGGGAAAGGG + Intergenic
982660627 4:158202068-158202090 CTGTGGTTGAGGTGGAAAGAAGG - Intronic
982689551 4:158532480-158532502 CTGTTGGTCAGAAGGGGAGAAGG - Intronic
983344011 4:166502910-166502932 CCTTGGGTTATGAGGGCAGAGGG + Intergenic
983964455 4:173792461-173792483 CTGTGGGCTTTGAGGGCAGAGGG + Intergenic
985485628 5:146668-146690 CTGTGGGGGAGGAGAGGAGGGGG - Intronic
985511537 5:316779-316801 CAGAGGGTGAGGAGGGCGGTGGG + Intronic
985515908 5:344388-344410 CTGCGGGTGGGGAGGGCTGCGGG + Intronic
985543975 5:500112-500134 CTGTGGGTTGAAAGGGCAGAGGG + Intronic
985599498 5:819309-819331 CTGTGGGTGAGAGAGACAGACGG - Intronic
985773012 5:1824828-1824850 CTGAGGGTGGGGAGGGAAGCAGG + Intergenic
985794256 5:1950236-1950258 CTCTCGGTGTGGAGGGAAGAGGG + Intergenic
985868633 5:2536438-2536460 CTGTGGGTGAGGAGAGGCCAGGG - Intergenic
986295954 5:6438841-6438863 CTATGGGTGAGGGAGGCAAAGGG - Intergenic
986555630 5:9007863-9007885 CTGGGTGTGAGGAGGGGAGGTGG + Intergenic
986643665 5:9895457-9895479 CTGTGGCTGAGCCGGGCAGCAGG + Intergenic
986685500 5:10272459-10272481 CTGTGGGTGGAGGGAGCAGAAGG - Intergenic
987182769 5:15385052-15385074 CTCTGGGGGAGAAGGGGAGAGGG - Intergenic
988398870 5:30734692-30734714 CTGAGAATGAGGAGAGCAGAGGG + Intergenic
988731950 5:33981187-33981209 CTCTGTGTAAGGAAGGCAGAGGG - Intronic
990149261 5:52798726-52798748 ATTTGTGTCAGGAGGGCAGAGGG + Intronic
992636272 5:78728593-78728615 CTGGGGGTGAGGTGGGAAGTTGG - Intronic
992872761 5:81023068-81023090 TTGTGAGTGCGGAGGGTAGAGGG + Intronic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
993280406 5:85919315-85919337 AGGTGGATGAGGAGGCCAGAAGG + Intergenic
993532546 5:89042141-89042163 CTGTGCAGGAGGTGGGCAGATGG + Intergenic
994653560 5:102560757-102560779 CTGTGGGTGGTGGGGGAAGAGGG + Intergenic
994985357 5:106926526-106926548 CTGAGAGACAGGAGGGCAGAAGG - Intergenic
995594741 5:113735690-113735712 TTGGGGGTGAGGTGTGCAGAGGG - Intergenic
996982726 5:129519374-129519396 TTGTGCTTGAGGAGGGGAGAGGG - Intronic
997046139 5:130320445-130320467 CTGTGGTTGGGTAGGGGAGAGGG + Intergenic
997230068 5:132235819-132235841 CTGTGGGTGAGTGGGGGAGAAGG + Intronic
997264254 5:132485951-132485973 CTGAGGGTGAGGAAGGAAGTAGG - Intronic
997266444 5:132497690-132497712 CTGTGGGGGAGCAGGTCAGAAGG - Intergenic
997976853 5:138445941-138445963 CTGTGGGGGTTGAGGGTAGAGGG + Exonic
998133481 5:139662661-139662683 CCGTGGTTGAGGAGGAGAGAGGG + Intronic
998305259 5:141069804-141069826 GGGAGGCTGAGGAGGGCAGATGG + Intergenic
998370113 5:141655484-141655506 ATGGGGGTGAAGAAGGCAGAAGG + Intronic
998432795 5:142080941-142080963 CTATGGGTCAGGAAAGCAGATGG + Intergenic
998729923 5:145062923-145062945 CTGTGTGTGGGGAGGGCAGTGGG + Intergenic
998816280 5:146017442-146017464 CTGTGAGTGTGGGAGGCAGAGGG - Intronic
999098363 5:149002045-149002067 CGGTGGGTGAAGAGTACAGAGGG - Intronic
999247964 5:150165490-150165512 CTCTGGGTCAGGAAGTCAGATGG - Intergenic
1000198605 5:158985837-158985859 GTGTGTGTGAGAAGGGCAGGAGG + Intronic
1000285174 5:159820444-159820466 TGGAGGGTGAGGAGGGCAGGGGG - Intergenic
1000648670 5:163787737-163787759 ATGTGGAAGAGGAAGGCAGAAGG - Intergenic
1000919410 5:167120382-167120404 CTGTGGGAGAGGAGGGGAAGTGG + Intergenic
1001270868 5:170310739-170310761 CTGGGGGTAACGAGGGCAGTGGG + Intergenic
1001773220 5:174311295-174311317 CTGTGTGTGAGGAGGCCCGGGGG + Intergenic
1001851552 5:174971380-174971402 CTGTGTGGGAGTTGGGCAGAAGG + Intergenic
1002067784 5:176660874-176660896 CTCTGGGTGAGGTGGTCATATGG + Intergenic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002320886 5:178375257-178375279 CTGGGGGAGAGGAGGGGAGGTGG + Intronic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1003436318 6:6091731-6091753 GTGTGAGTGAGGAGCTCAGATGG + Intergenic
1003489658 6:6610383-6610405 CTGTGGGTCATAAAGGCAGAGGG - Intronic
1003550529 6:7098684-7098706 CTGAGGGTAAGGAGAGAAGAAGG - Intergenic
1003685722 6:8300063-8300085 CTGTGGGGGAGTATGGCAGAGGG - Intergenic
1003761429 6:9182732-9182754 ATATGTGTGAGGAGGGCAGGGGG + Intergenic
1004356442 6:14933520-14933542 CTGAGGGTGGGAAGGCCAGAGGG + Intergenic
1004505545 6:16244006-16244028 ATTTGGGTGAGAAGGGAAGAGGG + Intronic
1004667356 6:17760916-17760938 CTGTGGGTGGGGTGGGGAGGTGG - Intronic
1004980906 6:21022599-21022621 TTGTGTGTGAGGAGGGAAGGGGG + Intronic
1005280336 6:24267165-24267187 GTGAGGGTGAGGAGTGGAGATGG + Intronic
1005882155 6:30070065-30070087 CTCTGGGAGAGGAAGGAAGAGGG + Exonic
1005923269 6:30418759-30418781 CTGTAGGTGAGGAGGGCCTGGGG + Intergenic
1006052278 6:31354417-31354439 CTGGGGGTGGGTGGGGCAGAGGG - Intronic
1006109441 6:31735855-31735877 CTGAGGGTGAGTAGTGCAGTAGG - Intronic
1006606714 6:35262666-35262688 ATGTGGCTGAGGATGGCAGAAGG - Intronic
1006642192 6:35495275-35495297 CTTTGGGTGAGGATGGGAGCAGG + Intronic
1006699754 6:35962484-35962506 CTGAGGAAGGGGAGGGCAGAGGG - Intronic
1007119033 6:39365372-39365394 CTGTGGGTGATGTGGACAGGCGG - Intronic
1007287957 6:40761791-40761813 CTATGGGTGAACAGGACAGAGGG + Intergenic
1007412879 6:41674946-41674968 GTGTGGGTGAGGAGGGCTAGAGG + Intergenic
1007600353 6:43077125-43077147 CTGCGGGTGAGGGCGGAAGAAGG + Intronic
1007835779 6:44672524-44672546 CTGTGGGAGAGGATGGGGGATGG + Intergenic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1009478149 6:64121062-64121084 CTATGGGGGAGGGGGGCACATGG - Intronic
1009933801 6:70208201-70208223 CTGAGGGTGATGAGGTCATAAGG - Exonic
1011488627 6:87868760-87868782 CTGGGTGAGAGGAGGGAAGAAGG - Intergenic
1012047773 6:94300760-94300782 CTGTGCGTGAGGAGAAGAGAGGG + Intergenic
1012370411 6:98498663-98498685 GTGGGAGTGAGGAGGGCAGTAGG + Intergenic
1012426629 6:99122066-99122088 CTGTCAGTGAGGAAGGGAGAAGG - Intergenic
1012827024 6:104159248-104159270 CTTTGGGTAGGGAGGGTAGAGGG + Intergenic
1012953688 6:105545659-105545681 GTGTGGATGAGGAGAGCAGAAGG - Intergenic
1013932838 6:115555481-115555503 CTCTGGGAGATGAGGGAAGATGG - Intergenic
1015147670 6:130005590-130005612 CTGTGGGGCAGGAGGGCAGTGGG + Intergenic
1015228127 6:130882211-130882233 GTGTGGGGGAGGAGGGAAGGAGG - Intronic
1016400545 6:143675533-143675555 CTGGGGGTGAGGAGGCAGGAGGG - Intronic
1016725231 6:147357584-147357606 CTGCGGGTGAGGAGATCAGCTGG + Intronic
1016986887 6:149901691-149901713 CTGTGGATGAGGAAGGCATCAGG - Intergenic
1017780992 6:157715165-157715187 CTGAGCGTGAGGAAGGCATAGGG - Intronic
1017905930 6:158757539-158757561 TTGTGGGTGGGGTGGGCGGAGGG + Intronic
1018483360 6:164214331-164214353 CTGTGTGTGTGGAAGGCAGTTGG + Intergenic
1018702681 6:166439651-166439673 ATGTGGGTGAGGGGGGCTGCTGG + Intronic
1019143935 6:169964824-169964846 CTGAGGGTGAGCAGGGGTGAGGG + Intergenic
1019261532 7:84546-84568 CTCTGGGTGAGGAGTGAGGAAGG - Intergenic
1019478201 7:1254311-1254333 CGGTGGGTGGGGAGGGCCGCTGG - Intergenic
1019486035 7:1289576-1289598 CTGTGGGTTTGGAGGGTGGAAGG - Intergenic
1019575611 7:1736259-1736281 GTGTGGGGGAGGCGGGGAGATGG - Intronic
1019645873 7:2128723-2128745 CCCAGGGTGAGAAGGGCAGAGGG - Intronic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1020278062 7:6636840-6636862 TTGTGGGTGGGGAGGGAGGAGGG - Intergenic
1021142726 7:17047676-17047698 TTGTGGGTCAGGGAGGCAGAAGG - Intergenic
1021717259 7:23471129-23471151 GAGTGGGTGAGGGGGGCAGGGGG + Intergenic
1021961512 7:25877805-25877827 CTCTCGGTGAGGAGAGAAGAGGG + Intergenic
1022091388 7:27110190-27110212 CTGTGGGTGAGTTGAGCAGGGGG + Exonic
1022229982 7:28405329-28405351 CTCTGAGTGATGTGGGCAGAAGG + Intronic
1022283762 7:28935615-28935637 CTGGGGGTGGGGCAGGCAGAGGG + Intergenic
1022417366 7:30189777-30189799 CTGAGAGACAGGAGGGCAGAAGG - Intergenic
1022422078 7:30232777-30232799 TTGGGGGTGGTGAGGGCAGAAGG + Intergenic
1022734555 7:33063389-33063411 CTGGGGGTGAGGAGGGGCGCAGG + Intergenic
1023062626 7:36343324-36343346 CTGTAGGAGAGGAGAGGAGAGGG + Intronic
1023522815 7:41065845-41065867 CTGTGGGTGGGGAAGGCGGGAGG + Intergenic
1023866375 7:44240323-44240345 TTGTGCGGGAGGTGGGCAGAAGG - Intronic
1023956600 7:44891650-44891672 CTGAGGCTGAGGAGAGGAGAGGG + Intergenic
1024300650 7:47885088-47885110 CTCTGGGAAAGGAGGGCTGAGGG - Intronic
1024578921 7:50785988-50786010 CTGTGCGTGTGTGGGGCAGAGGG + Intronic
1024604640 7:51013653-51013675 CTGTGGGGGACGAGGGGAGGAGG - Intergenic
1024804147 7:53116775-53116797 CTGGGGGAGAGGAGGGCATATGG + Intergenic
1024961939 7:54985861-54985883 GTGTGGCTGAGCAGGACAGAGGG + Intergenic
1025913005 7:65842442-65842464 CTGGGGGTGAGGAGGGGAATGGG + Intergenic
1025996236 7:66529251-66529273 CTGTGGGAGAGGAAGGAGGATGG + Intergenic
1026287692 7:68977665-68977687 CTGGGGGAGAAGAGGGCAGAAGG + Intergenic
1026879516 7:73899910-73899932 CTGTGAGTCAGTGGGGCAGATGG - Intergenic
1026988200 7:74568157-74568179 CTGTGGGAGAGGAAGGAGGATGG + Intronic
1027224990 7:76238072-76238094 CTGAGGATGGGGAGGGCAGGGGG - Intronic
1027371832 7:77514320-77514342 ATGTGGTTGGGGAGGGAAGAAGG - Intergenic
1027455861 7:78390949-78390971 CTTTGGGTGAGGGTGGGAGATGG + Intronic
1028894575 7:96026857-96026879 CTGTGTGTGAGGGGGATAGATGG - Intronic
1029334106 7:99885860-99885882 CTGGGGGTTGGGAGGGCAGGTGG + Intronic
1029438550 7:100575305-100575327 CTGGGGGAGAGGAGAGCAGGTGG + Intronic
1029930533 7:104365843-104365865 GTGTGGGCGGGGAGGGGAGATGG + Intronic
1030331866 7:108279625-108279647 GGGTGGGTGGGGAGGGCAGGGGG - Intronic
1030689440 7:112517455-112517477 ATGCTGGTGAGGATGGCAGAGGG - Intergenic
1030772372 7:113490082-113490104 TTGTGGGGCAGGGGGGCAGAGGG + Intergenic
1031966377 7:128031027-128031049 GTGGGGGCGGGGAGGGCAGAGGG + Exonic
1032390646 7:131553338-131553360 CTGTGGGAGAGGGAGGCATATGG - Intronic
1032503470 7:132417706-132417728 AGGTGGGGGAGGAGGGGAGAGGG + Intronic
1032547518 7:132756128-132756150 CTTTGGGAGCAGAGGGCAGAAGG - Intergenic
1032706405 7:134424035-134424057 CTGTGAGGGAAGAGGGCAGGTGG + Intergenic
1032901327 7:136312280-136312302 GTGTGGGTGGGAAGGGGAGAAGG - Intergenic
1033459029 7:141528734-141528756 CTGTTGGAGAGGAGGGGAGATGG - Intergenic
1034276854 7:149827656-149827678 CTGTGGCTGAGAAGGCAAGATGG + Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034289859 7:149921263-149921285 CTGTGGGAGAAGAGTCCAGAAGG - Intergenic
1034298339 7:149993662-149993684 CTGTGGGTGGGGATTGCAAAGGG - Intergenic
1034355163 7:150445440-150445462 GAGTGGGTGGGGAGGGGAGAGGG + Intergenic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1034807675 7:154103120-154103142 CTGTGGGTGGGGATTGCAAAGGG + Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035173906 7:157037100-157037122 GTGGGGATGAGGAGGGCAGGAGG - Intergenic
1035301090 7:157897573-157897595 GTGTGGGAGAGGAGAGCAGCCGG - Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035414095 7:158668262-158668284 AGGTAGGTAAGGAGGGCAGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035473312 7:159125385-159125407 CCCTGGGTGAGGAGGACACAAGG + Intronic
1035617656 8:1014023-1014045 CTGTGTGTGACCAGGACAGACGG + Intergenic
1035617843 8:1015401-1015423 CTGTGTGTGACCAGGACAGACGG + Intergenic
1035617864 8:1015560-1015582 CTGTGTGTGACCAGGACAGACGG + Intergenic
1035617952 8:1016235-1016257 CTGTGTGTGACCAGGACAGACGG + Intergenic
1035618137 8:1017590-1017612 CTGTGTGTGACCAGGACAGACGG + Intergenic
1036293721 8:7518136-7518158 CACTGGGTGGGGAGGGGAGAGGG - Intergenic
1036328840 8:7802859-7802881 CACTGGGTGGGGAGGGGAGAGGG + Intergenic
1036988193 8:13560764-13560786 CTGTGGGGGGGGAGGGAAAAAGG + Intergenic
1037693991 8:21207899-21207921 CTGTGGGGGTGGGGGGTAGAGGG - Intergenic
1037896253 8:22658285-22658307 CTGTGTGTACGGAGGGCAAAGGG + Intronic
1041021484 8:53642969-53642991 CTTGGGGAGAGGAGAGCAGAAGG - Intergenic
1041477130 8:58278938-58278960 CAGTAGGGGAGGAGAGCAGAAGG - Intergenic
1041747694 8:61226735-61226757 CTGAGGCTGGGGAGGGAAGAGGG + Intronic
1042104884 8:65315797-65315819 CTGTGGAAGAGGATGGCAGAAGG - Intergenic
1042901500 8:73732808-73732830 TGGTGGGAAAGGAGGGCAGACGG - Intronic
1043555045 8:81420956-81420978 CTGTGGGACATGGGGGCAGAGGG + Intergenic
1043555214 8:81422267-81422289 ATTTGGGTGAGGAGGACACAGGG - Intergenic
1043769538 8:84182239-84182261 CTGAAGGTGAGGGTGGCAGAGGG - Intergenic
1043837654 8:85064677-85064699 CTGGGTGTGAGGAGGGGAGGTGG - Intergenic
1044488527 8:92783381-92783403 CTGTGTGTAAGGAGAGCTGACGG + Intergenic
1044789437 8:95832692-95832714 GTGTGGGAGAAGGGGGCAGATGG + Intergenic
1044931863 8:97259301-97259323 CTGTAGGTGGGGAGGGCAAGGGG - Intergenic
1045268852 8:100644581-100644603 CTGCAGGTGAGGATGACAGAGGG + Intronic
1045967028 8:108036679-108036701 CTGGGGGTGAGGTGGGAGGAAGG + Intronic
1046660939 8:116947909-116947931 GTGTGGGTGAAAAGAGCAGAGGG - Intergenic
1047024262 8:120810330-120810352 ATGTGGGGGAGAAGGGCATATGG - Intronic
1047318640 8:123757502-123757524 CTGAGGCTGAAGAGGGGAGAGGG + Intergenic
1047368873 8:124238357-124238379 CTGTATGTGAGGAGGGAAGGTGG - Intergenic
1047625825 8:126655070-126655092 CTTTGGGAGATGGGGGCAGAAGG + Intergenic
1048209678 8:132444268-132444290 GGCTGGGTGAGGAGGGCAGGAGG - Intronic
1048279676 8:133095909-133095931 AGGTGGGTGAGGAAGGCAGGAGG - Intronic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1049113406 8:140664595-140664617 CAGTGGATGAGGAAGGCACATGG - Intronic
1049187479 8:141265200-141265222 CTGTGGGTGAGGAGGACCAGAGG - Intronic
1049241858 8:141541856-141541878 TGGTGGGACAGGAGGGCAGAGGG - Intergenic
1049281977 8:141754114-141754136 CTGTGGGTGAGGCGGGAGAATGG - Intergenic
1049674858 8:143884904-143884926 TGGTGAGTGAGGGGGGCAGATGG - Intergenic
1049807108 8:144546074-144546096 CTGAGGGTGAGGCGGGAGGAAGG + Intronic
1049854897 8:144855255-144855277 CAGGGGGAGAGGAGGGCAGTAGG + Intergenic
1050226854 9:3468335-3468357 CTCTGGGTGAGGGGCACAGATGG - Intronic
1050348403 9:4716246-4716268 TTGTGGGTGAGGTGGGGAGCTGG - Intronic
1050513052 9:6413983-6414005 CAGAGGGCGGGGAGGGCAGAGGG + Intronic
1051318577 9:15872738-15872760 CTGTGGTTCAGAAGGGTAGAAGG + Intronic
1051442174 9:17097064-17097086 CTGTGAGTGTGTAGGGCAGGAGG - Intergenic
1051888657 9:21921729-21921751 GTGAGGCTGAAGAGGGCAGATGG + Intronic
1052043547 9:23768595-23768617 CAGTGGGTGAGGGTGGCTGATGG - Intronic
1052331684 9:27276549-27276571 CTGTGGGTGGGGTGGGGAAACGG + Intergenic
1052844250 9:33321152-33321174 CTGTTGGTGATGAGAGAAGAAGG + Intronic
1053150285 9:35738904-35738926 CTGTGGGAGAGGAGGGGACTTGG + Intronic
1053334141 9:37249092-37249114 ATGTGGGAGAGGTGGGGAGATGG + Intronic
1053477652 9:38393621-38393643 CTGAGGGTGAGGAGACCAAAAGG - Intronic
1053599355 9:39594320-39594342 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1053647389 9:40131378-40131400 CTGTGGGCTAGGGGGGCAGCTGG - Intergenic
1053758338 9:41332465-41332487 CTGTGGGCTAGGGGGGCAGCTGG + Intergenic
1053791432 9:41688885-41688907 CTGGGGGTGAGGATGTCAAACGG + Intergenic
1053857060 9:42348506-42348528 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1054473509 9:65557005-65557027 CTGGGGGTGAGGATGCCAAACGG - Intergenic
1054537190 9:66244792-66244814 CTGTGGGCTAGGGGGGCAGCTGG + Intergenic
1054657760 9:67680242-67680264 CTGGGGGTGAGGATGTCAAACGG - Intergenic
1054720185 9:68596104-68596126 TTGAGGCTGAAGAGGGCAGAGGG - Intergenic
1054743925 9:68835294-68835316 CTGCTGGTGAGGAAGGAAGACGG - Intronic
1054758363 9:68981476-68981498 GTGGGGGTGGGGAGGGCAGGAGG + Intronic
1055576148 9:77661824-77661846 GGTTGGGTGAAGAGGGCAGAGGG - Intergenic
1056812688 9:89776625-89776647 CTGTGGGGCAAGGGGGCAGATGG + Intergenic
1057184413 9:93048875-93048897 CTCAGGGTGAGGAGTGCAGGGGG + Intergenic
1057307435 9:93920459-93920481 CTGGGGGTCAGGAGTGAAGAAGG + Intergenic
1057553453 9:96068866-96068888 ATGTGAGTGGGGAGGGGAGAGGG - Intergenic
1057743784 9:97735283-97735305 CTGTGGGAGGGGAGAGAAGAGGG + Intergenic
1058021994 9:100099178-100099200 CTGTGGGATAGAAGGGCGGAGGG + Intergenic
1058412147 9:104745979-104746001 CTGAGGCTGAGGAGGGAAGAAGG - Intergenic
1058655120 9:107213262-107213284 GTGAAGGTGAGTAGGGCAGAGGG - Intergenic
1058923592 9:109640733-109640755 GTGCGGGTGGGGAGGGGAGACGG + Intergenic
1058952198 9:109914405-109914427 CTGTGGCTGAGCTGGGCATATGG - Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059328151 9:113517238-113517260 CTGGGGCTGAGGACTGCAGAGGG + Intronic
1059457077 9:114406463-114406485 CAGAGGGTGATGGGGGCAGAAGG + Exonic
1059463262 9:114448861-114448883 CTGTGGGTGAGGAAGTGACAAGG - Intronic
1059510328 9:114839391-114839413 CTGTCTGTGTGGAGGCCAGAGGG + Intergenic
1059700284 9:116769334-116769356 CTGTGAGTGATGAGTGTAGAAGG + Intronic
1059821953 9:117983390-117983412 CAGATGGTGATGAGGGCAGAGGG + Intergenic
1060101778 9:120847057-120847079 CTCTGGGTGAGGAGAGAAGCAGG - Intergenic
1060104349 9:120864117-120864139 CTGTGGGAGAGCAGGCCAGCAGG + Intronic
1060217120 9:121745093-121745115 ATGTGGGGGAAAAGGGCAGACGG + Intronic
1060548095 9:124472311-124472333 CAGAGGGTGAGAAGGGCACAGGG - Intronic
1060801375 9:126547791-126547813 CTCTGGGTGGGGAGGGATGAGGG - Intergenic
1060859084 9:126939074-126939096 AAGTGGGAGAGGGGGGCAGAGGG + Intronic
1060882142 9:127124675-127124697 TTGTGGCTGAGGAGAGAAGATGG + Intronic
1060925864 9:127454696-127454718 CTGTGGGTGGGGGAGGCAGATGG - Intronic
1060934136 9:127506037-127506059 CTGTGGGCCAGGCGGGCAGGAGG + Exonic
1060973717 9:127753294-127753316 ATGTGGGGGAGCAGGGCGGAGGG + Intronic
1061177769 9:129007956-129007978 CTGTGGAAGAGTGGGGCAGAGGG + Intronic
1061419218 9:130464217-130464239 CTGATGGGGAGGAGGGCACAGGG + Intronic
1061498554 9:130989679-130989701 CCATGGGAGAGGAGGGCAGGGGG - Intergenic
1061670370 9:132185074-132185096 CTGGGGGTGGGGAGGCTAGAGGG + Intronic
1062061312 9:134496814-134496836 CTGGGGGAGAGGTGTGCAGATGG - Intergenic
1062303109 9:135886945-135886967 GTGTGGAGGAGGAGGGCAGTCGG + Intronic
1062315073 9:135963091-135963113 CTGTGGGAGGGGAGGCCAGCAGG + Intergenic
1062489112 9:136795939-136795961 CTGGGGGTGGGGGGTGCAGAGGG + Intronic
1062498736 9:136843432-136843454 CTGGGGGTGGGCAGGGCGGAGGG - Intronic
1062562174 9:137146491-137146513 GTCTTGGTGAGGAGTGCAGAGGG - Intronic
1186434174 X:9528876-9528898 CTTTGGGTGAGGGTGGCAGCTGG + Intronic
1186656713 X:11619915-11619937 GTGAGGGAGAGGAGGGCAGCAGG - Intronic
1186771412 X:12821444-12821466 CTGGGGGTGGGGGGGGCAGTGGG + Intronic
1186915362 X:14213337-14213359 CTTTAGGGGATGAGGGCAGAGGG + Intergenic
1187326601 X:18295765-18295787 CTGTGGATGAGGACGCCAGGTGG - Intronic
1187391359 X:18888436-18888458 CTGTGTGTCAGGAGTGAAGAGGG - Intergenic
1187566180 X:20451721-20451743 GTGTGGCTGAGGCGGGGAGAAGG - Intergenic
1187673577 X:21692667-21692689 CTGTGGGTGAGAAGTCCAGGTGG - Intergenic
1188010394 X:25049146-25049168 CTGGGGGTGAGGAGTGGACAAGG + Intergenic
1189478668 X:41376462-41376484 CAGAGGGTGAGCCGGGCAGAAGG - Intergenic
1189665571 X:43351153-43351175 CCCTGGGTCACGAGGGCAGAGGG + Intergenic
1191716656 X:64198355-64198377 GGGTGGCTGAGGAGGGCAAATGG - Intronic
1191780807 X:64863200-64863222 CTGTGGGGGAGGTGGGGAGAGGG - Intergenic
1192224528 X:69219231-69219253 CTGTGGGAAAGGAGGCCAGGAGG - Intergenic
1192229372 X:69254617-69254639 CTGGGGGTGGGGAAGGGAGAAGG + Intergenic
1193926320 X:87489727-87489749 CTGGGGGTGGGGTGGGGAGAGGG + Intergenic
1194125260 X:90008623-90008645 CCCAGGGTGATGAGGGCAGAGGG + Intergenic
1195255970 X:103091561-103091583 CTGTGGGTGGGCAGGGTAGGGGG + Intronic
1195889133 X:109672284-109672306 ATGGGGGTGGGGAGGGGAGAGGG + Intronic
1195967876 X:110445484-110445506 CTGTGGGGGAGGAAGGAAGTGGG + Intronic
1196794797 X:119493542-119493564 CTGTGGGTGGCGAGGGAACAGGG - Intergenic
1196836728 X:119820462-119820484 GTGGTGGTGAGGGGGGCAGATGG + Intergenic
1197515606 X:127423973-127423995 CTGAGGAGGAGGAGGACAGAGGG - Intergenic
1197825808 X:130589137-130589159 GTGGGGGTGGGGAGAGCAGAAGG - Intergenic
1197861849 X:130979551-130979573 CTCTGGGTGAGGTGGGCAAAAGG - Intergenic
1198734990 X:139775696-139775718 CCCTAGGTAAGGAGGGCAGAGGG - Intronic
1199833904 X:151569747-151569769 CTGAGGGTGGGGTGGGGAGAGGG + Intronic
1200078738 X:153565185-153565207 CTGTGGGTGTCGGGTGCAGACGG - Intronic
1201018435 Y:9626840-9626862 GTGTGAGTGAGGATGGCAGAGGG - Intergenic
1201742373 Y:17337613-17337635 CTGGGGGTCAGCAGGGCTGAAGG + Intergenic
1202110265 Y:21409885-21409907 GTGTGAGTGACGATGGCAGAGGG - Intergenic
1202119277 Y:21507806-21507828 GTGTGGGTGATGATGGCAGAGGG + Intergenic
1202121729 Y:21531346-21531368 GTGTGGGTGATGATGGCAGAGGG + Intronic
1202157276 Y:21898036-21898058 GTGTGGGTGATGATGGCAGAGGG - Intronic
1202159723 Y:21921577-21921599 GTGTGGGTGATGATGGCAGAGGG - Intergenic