ID: 1117171867

View in Genome Browser
Species Human (GRCh38)
Location 14:53108465-53108487
Sequence CGCTGCCATCTTGGGAGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 6, 2: 49, 3: 133, 4: 211}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117171858_1117171867 23 Left 1117171858 14:53108419-53108441 CCCCAGGTCAGAGAACGTGAGAC 0: 1
1: 6
2: 28
3: 182
4: 289
Right 1117171867 14:53108465-53108487 CGCTGCCATCTTGGGAGCTCTGG 0: 1
1: 6
2: 49
3: 133
4: 211
1117171860_1117171867 21 Left 1117171860 14:53108421-53108443 CCAGGTCAGAGAACGTGAGACTT 0: 1
1: 6
2: 29
3: 186
4: 274
Right 1117171867 14:53108465-53108487 CGCTGCCATCTTGGGAGCTCTGG 0: 1
1: 6
2: 49
3: 133
4: 211
1117171862_1117171867 -3 Left 1117171862 14:53108445-53108467 CCACAAGCTTGGAAGCAGCCCGC 0: 1
1: 0
2: 25
3: 65
4: 230
Right 1117171867 14:53108465-53108487 CGCTGCCATCTTGGGAGCTCTGG 0: 1
1: 6
2: 49
3: 133
4: 211
1117171859_1117171867 22 Left 1117171859 14:53108420-53108442 CCCAGGTCAGAGAACGTGAGACT 0: 1
1: 6
2: 28
3: 190
4: 317
Right 1117171867 14:53108465-53108487 CGCTGCCATCTTGGGAGCTCTGG 0: 1
1: 6
2: 49
3: 133
4: 211
1117171857_1117171867 30 Left 1117171857 14:53108412-53108434 CCAAGAACCCCAGGTCAGAGAAC 0: 284
1: 171
2: 65
3: 40
4: 202
Right 1117171867 14:53108465-53108487 CGCTGCCATCTTGGGAGCTCTGG 0: 1
1: 6
2: 49
3: 133
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117171867 Original CRISPR CGCTGCCATCTTGGGAGCTC TGG Intronic
901811330 1:11768260-11768282 CGCTGACCTCTCGGAAGCTCCGG - Exonic
902567668 1:17323195-17323217 AGCTGCCATTTTGTGAGCTATGG - Intronic
903213229 1:21830010-21830032 CGCTGCCACCTGGGCCGCTCGGG - Exonic
903337614 1:22635464-22635486 CCCTGCAATCTTGGGGGCCCGGG - Intergenic
905881632 1:41467826-41467848 CCCTGCCCACTTGGGACCTCTGG + Intergenic
906507468 1:46390844-46390866 CGCCACCATCTTGGGAGCTCTGG - Intergenic
906690520 1:47789820-47789842 TGCTGCCTTCTTGGAACCTCAGG + Intronic
907504900 1:54911031-54911053 CGCCACCATCTTGGGAGCTCTGG - Intergenic
907506020 1:54918816-54918838 CGCCACCATCTTGGGAGCTCTGG - Intergenic
907526043 1:55054682-55054704 CTCTGCCAGCCTGTGAGCTCTGG - Intronic
908264863 1:62368480-62368502 CACTGCCTTCTTCAGAGCTCTGG + Intergenic
910116616 1:83738847-83738869 CGCCACCATCTTGGGAGCTCTGG - Intergenic
910590567 1:88924987-88925009 CGCCGCCATCTTGGGAGCTCTGG + Intergenic
912285662 1:108365951-108365973 CACCACCATCTTGGGAGCTCTGG - Intergenic
912648635 1:111418720-111418742 AGTTGGCATTTTGGGAGCTCTGG - Intronic
915767230 1:158374634-158374656 TGCTGCCAAATTGGGAGCCCAGG + Intergenic
916147090 1:161749795-161749817 CGCGGCCATGTTGGAGGCTCCGG + Exonic
919174401 1:194001720-194001742 CGCCGCCAAATTGGGAGCCCAGG - Intergenic
919701737 1:200638292-200638314 TGCTGCCACCTGGGGAGCACAGG + Intronic
920623964 1:207577897-207577919 CGCTGCAATCTTGGAAGCAGAGG + Exonic
920639793 1:207741177-207741199 CGCCACCATCTTGGGAGCTCTGG - Intergenic
920912335 1:210230793-210230815 CACTGGCATCTTTGGAGCTTTGG - Intergenic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
921384081 1:214551865-214551887 CGCCTCCAGCTCGGGAGCTCGGG - Intronic
922007876 1:221550696-221550718 CGCCACCATCTTGGGAGCTCTGG - Intergenic
922876361 1:228942852-228942874 TGCCACCATGTTGGGAGCTCTGG + Intergenic
922877825 1:228954253-228954275 CGCCACCATGTTGGGAGCTCTGG + Intergenic
1062841085 10:672428-672450 CACAGCCATCCTGGGTGCTCTGG - Intronic
1062841180 10:673129-673151 CACAGCCATCCTGGGTGCTCTGG - Intronic
1063071915 10:2675372-2675394 CCCTCCCATCTTTGGAGCTGTGG - Intergenic
1064408894 10:15088567-15088589 CACTGCCATCTGGGGCGCTGGGG + Intronic
1065199774 10:23301549-23301571 CACCACCATCTTGGGAGCTCTGG - Intronic
1066672956 10:37859116-37859138 CACCACCATCTTGGGAGCTCTGG - Intergenic
1070801878 10:79248668-79248690 CTCTGCCTTCTGAGGAGCTCCGG + Intronic
1070826001 10:79390993-79391015 CCCTCCCAGCTTGGGAGCTCAGG + Intronic
1070872974 10:79774072-79774094 CGCTGCCCTCCTGGTATCTCAGG - Intergenic
1071051935 10:81460524-81460546 CACCACTATCTTGGGAGCTCTGG + Intergenic
1071326666 10:84525393-84525415 TGCCACCATCTTGAGAGCTCTGG - Intergenic
1071327357 10:84530333-84530355 TGCCACCATCTTGGGAGCTCTGG - Intergenic
1071557048 10:86612400-86612422 TGCCACCATGTTGGGAGCTCTGG + Intergenic
1072731675 10:97850512-97850534 CGCGGACAGCTTGGGGGCTCAGG - Intronic
1074270862 10:111952152-111952174 TGCTTCTCTCTTGGGAGCTCTGG + Intergenic
1074682006 10:115916763-115916785 AGCTGCAGCCTTGGGAGCTCAGG + Intronic
1074978408 10:118599555-118599577 CACCACCATCTTGGGAGCTCTGG - Intergenic
1075769016 10:124917435-124917457 CGCTTCCATCTTGGGCGCTCCGG + Intergenic
1076134581 10:128036617-128036639 GGTTTCCATCTTGGGAGCTGGGG - Intronic
1076946033 10:133651196-133651218 CGCCACCATCTTGGGCGCTCTGG + Intergenic
1077432377 11:2522218-2522240 CCACGCCCTCTTGGGAGCTCGGG + Intronic
1077583856 11:3435425-3435447 TGCTGCCAAATTGGGAGCCCAGG + Intergenic
1079601683 11:22317600-22317622 TGCCACCATCTTGGGAGCTCTGG - Intergenic
1079731823 11:23942759-23942781 TGCTGCCAAATTGGGAGCCCAGG + Intergenic
1079884221 11:25966198-25966220 CACCACCATCTTGGGAGCTCTGG - Intergenic
1080881421 11:36324998-36325020 CACCATCATCTTGGGAGCTCTGG - Intronic
1081069678 11:38595517-38595539 CACCACCATCTTGGGAGCTCTGG - Intergenic
1081623302 11:44631934-44631956 TGCTGCCCTCTCCGGAGCTCTGG - Intergenic
1081743464 11:45457034-45457056 CGCTACTAACTGGGGAGCTCAGG - Intergenic
1083273025 11:61581387-61581409 CGCGGCCATCGGGGGAGCACGGG - Intergenic
1084304435 11:68272226-68272248 CGCTGCCGTCTTGGGGTCCCGGG + Intergenic
1084831678 11:71774614-71774636 TGCTGCCAAATTGGGAGCCCAGG - Intergenic
1085403267 11:76246932-76246954 GGCTGCCATCTGGAGAGCACTGG + Intergenic
1086238215 11:84657978-84658000 CTCTGCCTTCTTGGAAGCTTTGG + Intronic
1088110152 11:106251473-106251495 CACCACCATCTTGGGAGCTCTGG + Intergenic
1088879868 11:113964848-113964870 CGCCACCATCTTGGGAGCTCTGG + Intergenic
1089376081 11:117995755-117995777 CCCTGCCCTCCTGGAAGCTCGGG - Intronic
1089711975 11:120322005-120322027 CCCTGGCAACCTGGGAGCTCCGG - Intergenic
1091121138 11:133058596-133058618 CGCTCCCATCAGGGCAGCTCTGG + Intronic
1091301342 11:134510024-134510046 GGCTGCCAGCCTGGGAGCTGAGG - Intergenic
1093106604 12:15095121-15095143 CGCCACCATCTTGGGAGCTCTGG - Intergenic
1093281718 12:17203803-17203825 CCCTGCCCTCTTGGGGGCCCAGG + Intergenic
1094742261 12:33303308-33303330 CGCTGCCGTCTTGGGGTCTATGG - Intergenic
1095552537 12:43459529-43459551 TGCCACCATCTTGGGAGCTCTGG + Intronic
1095893053 12:47252721-47252743 CCCCACCATCTTGGGAGCTCTGG - Intergenic
1096351168 12:50902498-50902520 TGCCACCATCTTGGGAGCTCTGG - Intergenic
1096352486 12:50911862-50911884 CACCACCATCTTGGGAGCTCTGG - Intergenic
1097066386 12:56323700-56323722 CACTGCCATCCAGGGATCTCTGG - Intronic
1097377698 12:58859016-58859038 TGCCACCATGTTGGGAGCTCTGG - Intergenic
1097840906 12:64320299-64320321 TGCCTTCATCTTGGGAGCTCTGG + Intronic
1099292676 12:80790414-80790436 CACCACCATCTTGGGAGCTCTGG + Intergenic
1101555234 12:105802686-105802708 CGACACCATCTTGGGAGCTCTGG - Intergenic
1102459138 12:113089464-113089486 CTCTGCCTTCTTGGGGGCCCAGG - Intronic
1102483046 12:113237099-113237121 TGCTGACATCTTGCCAGCTCGGG + Intronic
1104187805 12:126449297-126449319 CACCACCATCTTGGGAGCTCTGG - Intergenic
1106020023 13:25905622-25905644 CGCTGCCATCTGGGTTTCTCTGG + Intronic
1107156373 13:37172075-37172097 CGCCACCATCTTGGGAGCTCTGG - Intergenic
1108601109 13:51996059-51996081 CGCTGCCAACATTGGAGCTGTGG - Intronic
1109520566 13:63505224-63505246 CACCACCATCTTGGGAGCTCTGG - Intergenic
1109594070 13:64526162-64526184 CACCACCATCTTGGGAGCTCTGG + Intergenic
1110846196 13:80192769-80192791 TGCCTCCATCTTGGGAGCTCTGG + Intergenic
1110987018 13:81984103-81984125 TGCCTCCATCTTGGAAGCTCTGG - Intergenic
1111021504 13:82458045-82458067 TACCACCATCTTGGGAGCTCTGG + Intergenic
1111174723 13:84579768-84579790 TACCACCATCTTGGGAGCTCTGG - Intergenic
1111536742 13:89611762-89611784 CGCCACCATCTTGAGAGCTCTGG - Intergenic
1111709711 13:91795999-91796021 CGCCACCATCTTGGGAGCTCTGG - Intronic
1111820459 13:93207233-93207255 CGCCACCATCTCGGGAGCTCTGG + Intergenic
1111910209 13:94302736-94302758 CGTGGCCATCTTGGGAGCTCTGG - Intronic
1113721186 13:112558302-112558324 CACTCCGATCTTGGTAGCTCAGG + Exonic
1114340199 14:21735416-21735438 CTCTGCCACCTTGTGACCTCAGG - Intergenic
1114354319 14:21890744-21890766 CCCTGACCTCATGGGAGCTCTGG + Intergenic
1114384887 14:22244142-22244164 TGCCACCATCTTAGGAGCTCTGG + Intergenic
1116118745 14:40694394-40694416 CACCACCATCTTGGGAGCTCTGG - Intergenic
1116740391 14:48747061-48747083 CGCCACCATCTTGGGAGCTCTGG + Intergenic
1116981628 14:51176963-51176985 AGCTGCCCTCGTGGGAGGTCGGG - Intergenic
1117171867 14:53108465-53108487 CGCTGCCATCTTGGGAGCTCTGG + Intronic
1119089874 14:71771854-71771876 CGCCACCATCTTGGGAGCTCTGG - Intergenic
1120397450 14:83985944-83985966 CGCCACCATCTTGGGAGCTCTGG + Intergenic
1120916490 14:89715133-89715155 CTTTGCCATCTTGGGTGCTATGG - Intergenic
1121774585 14:96582418-96582440 GGCTGGCCTCTTGGGAACTCTGG + Intergenic
1122001065 14:98653871-98653893 TGCCACCATCTTGGGAGCTCTGG + Intergenic
1122770630 14:104096096-104096118 CGATGCCATCCTGGGGGCCCTGG + Intronic
1122798525 14:104218304-104218326 CGCTGCCACCATGTGGGCTCTGG - Intergenic
1123125522 14:105943228-105943250 TGCCACCATCTTGGGAGCTCTGG + Intergenic
1202920135 14_KI270723v1_random:23791-23813 CGCCACCATCTTGGGAGCTTTGG + Intergenic
1202924785 14_KI270724v1_random:13851-13873 TGCCACCATCTTGGGAGCTCTGG - Intergenic
1123706849 15:22956766-22956788 CGCTGGCATCTTGGGAGCCTGGG - Intronic
1125626884 15:41116145-41116167 CGCCGCCATCTTGGGGTCCCAGG - Exonic
1125906606 15:43398601-43398623 GGCTGCCAGTTTGTGAGCTCTGG + Intronic
1126728282 15:51655295-51655317 CACTGCCATCTTGGGAGCTCTGG - Intergenic
1126814270 15:52439224-52439246 TGCCACCATCTTGGGAGCTCTGG + Intronic
1126928993 15:53626103-53626125 CACCACCATCTTGGGAGCTTTGG - Intronic
1128363045 15:66976143-66976165 CGCCACCATCTTGGGACCTCTGG - Intergenic
1129088201 15:73119644-73119666 GGCTTCCTTCTTGGGAGCGCAGG + Intronic
1129746271 15:78023639-78023661 CCCTCCCATCTTGGGTGCTGGGG + Intronic
1129776316 15:78238988-78239010 CGCCACCATCTTGGGAGCTCTGG - Intronic
1130154743 15:81340083-81340105 AGCTGCCCTCAGGGGAGCTCTGG - Intronic
1131420175 15:92298628-92298650 TGCCACCATCATGGGAGCTCTGG + Intergenic
1133352226 16:5108992-5109014 TGCTGCCACATTGGGAGCCCAGG + Intergenic
1134049714 16:11128846-11128868 TGTTGCAATCTTGGGAGATCTGG - Intronic
1135937555 16:26793901-26793923 CTCTGCCATCTTGGGCACTTCGG - Intergenic
1136142980 16:28299021-28299043 CTTTTCCACCTTGGGAGCTCAGG + Intronic
1139150877 16:64380999-64381021 CCCTGCACTCTTGGGGGCTCAGG + Intergenic
1141445604 16:84055884-84055906 CTCTGCCTTCCTGGGAGCTGTGG - Intronic
1141810318 16:86371567-86371589 CTCAGCCATTTTGGGGGCTCAGG - Intergenic
1142278254 16:89134136-89134158 CGCTACCATCTTGGGAGCTCTGG - Intronic
1142967717 17:3591616-3591638 CTCTGCCTGCTCGGGAGCTCGGG + Intronic
1143717119 17:8782044-8782066 CTCTCCAATCTTGGGAGCACTGG - Intergenic
1144844345 17:18208404-18208426 CGCCGCCCTCCTGGGAACTCTGG + Exonic
1149169373 17:53791807-53791829 CCCTGCACTCTTGGGAGCTCAGG + Intergenic
1149428117 17:56574883-56574905 CCCTGCCATTTTGACAGCTCAGG - Intergenic
1150132891 17:62678829-62678851 CCCTGGCATCTTGGGAGAACAGG + Intronic
1151089217 17:71416173-71416195 TGCTGTCATGTTTGGAGCTCAGG + Intergenic
1151197808 17:72444478-72444500 CGATGCTATGTTGGGAGCTAGGG + Intergenic
1151406997 17:73894617-73894639 GGCTGCCCTCTTGCCAGCTCGGG - Intergenic
1152101097 17:78302131-78302153 TAGTGCCATCCTGGGAGCTCAGG + Intergenic
1152861141 17:82697768-82697790 GGCTGCCTGCCTGGGAGCTCTGG + Intronic
1153400832 18:4682386-4682408 CGCCACCATCTTGGGAGCTCTGG + Intergenic
1153402119 18:4692366-4692388 CACCACCATCTTGGGAGCTCTGG + Intergenic
1155749181 18:29398879-29398901 AGCCACCATCTTGGGAGCTCTGG - Intergenic
1157259394 18:46165439-46165461 CACTGTCATCTTGGGAGCTCTGG + Intergenic
1157782148 18:50449174-50449196 TGCCGCCATCTTGGGAGCTCTGG - Intergenic
1158152355 18:54387328-54387350 CACCACCATCTTGGGAGCTCTGG + Intergenic
1158470865 18:57735555-57735577 CACCACCATCTTGGGAGCTCTGG + Intronic
1159276184 18:66223798-66223820 TGCCACCATCTTGGGACCTCTGG + Intergenic
1159279717 18:66270115-66270137 CACCACCATATTGGGAGCTCTGG - Intergenic
1159609108 18:70507082-70507104 CACTGACATCTATGGAGCTCTGG - Intergenic
1160102710 18:75938183-75938205 CACCACCATCTTGGGAGCTCTGG - Intergenic
1160531670 18:79568744-79568766 CGCAGCCACCTTGGAAGCGCTGG + Intergenic
1161884596 19:6984436-6984458 AGCTGCCCTTTTGGAAGCTCAGG + Intergenic
1161948537 19:7454139-7454161 GGGTGCCATCTTGGGAGTTGTGG + Intronic
1162381319 19:10333499-10333521 CGCCGCCATCTTGGGAAACCCGG + Exonic
1163509694 19:17727316-17727338 CGCTGCCCTCTGCGGGGCTCCGG - Exonic
1164056931 19:21629836-21629858 TGCCACCATCTTGGGAGCTCTGG + Intergenic
1165304656 19:34996089-34996111 CGCTGCCCTGCTGGGAGGTCAGG - Intronic
1167117760 19:47498044-47498066 TGCTGCCACCTTGGTGGCTCTGG - Intronic
1167252054 19:48404640-48404662 GTCTGCCATATTGGGAGCTGTGG + Intronic
1167499623 19:49837745-49837767 AGGTGCCATGTTGGGAGCTCAGG + Intronic
1168078759 19:53994146-53994168 CGCTCCCATCCTGTGAGCCCTGG + Intronic
1168146951 19:54424909-54424931 CACCACGATCTTGGGAGCTCCGG - Intronic
1168306904 19:55440758-55440780 CTCTGCCACCTTTAGAGCTCTGG - Exonic
924973539 2:153416-153438 CACAACCATCTTGGGAGCTCTGG - Intergenic
924974455 2:160043-160065 TGCCACCATCTTGGCAGCTCTGG - Intergenic
926624851 2:15082637-15082659 CCCTGCCTCCTTGGGGGCTCTGG - Intergenic
926697955 2:15783962-15783984 CGCAGCCACATGGGGAGCTCTGG - Intergenic
926864046 2:17339647-17339669 CACCACCATCTTGGGAGCTCTGG + Intergenic
926865041 2:17346671-17346693 CACCACCATCTTGGGAGCTCTGG + Intergenic
928773610 2:34732444-34732466 CACCACCATCTTGGGAGCTCTGG - Intergenic
929542423 2:42832454-42832476 TGCCACCATCTTGGGAGCTCTGG + Intergenic
931039044 2:58276113-58276135 CACCACCATCTTGGGAGCTCTGG + Intergenic
932791749 2:74659512-74659534 AGCTGAATTCTTGGGAGCTCAGG - Intronic
933175672 2:79169855-79169877 TGCCACCATCTTGGGAGCTCTGG - Intergenic
933500265 2:83102127-83102149 AACCACCATCTTGGGAGCTCTGG + Intergenic
937908864 2:127065671-127065693 CGTTGCCATCTGGGGAGTTGTGG - Intronic
937972836 2:127564037-127564059 TCCAGCCACCTTGGGAGCTCTGG + Intronic
938790969 2:134675710-134675732 GGCTGCCCTGTTGGGAGCTCTGG - Intronic
939134029 2:138273180-138273202 CACCACCATCTTGGGAGCTCTGG - Intergenic
939493104 2:142899947-142899969 TGCCACCATCTTGGGAGCTCTGG - Intronic
940532035 2:154890055-154890077 CCCTGCCATTTTGGAATCTCTGG - Intergenic
942679549 2:178462898-178462920 CACCACCTTCTTGGGAGCTCTGG + Intergenic
943082096 2:183267673-183267695 CGCTGCCCTCATGGGAACACAGG + Intergenic
944279488 2:197878845-197878867 GGCTGCCAGTTTGAGAGCTCAGG - Intronic
945064830 2:205939881-205939903 CACCGCCGTCTTGGGAGCTCTGG + Intergenic
945395056 2:209306927-209306949 TACCACCATCTTGGGAGCTCTGG + Intergenic
948921076 2:241066198-241066220 CCCTGCAATCTTGGTGGCTCAGG - Intronic
949012238 2:241687237-241687259 CGCTGCCAGCGTGAGGGCTCCGG + Intergenic
1169135133 20:3192658-3192680 CGCTGCGCCCTTGGGAACTCAGG - Intronic
1171230500 20:23480477-23480499 AACTGCCATCTTCTGAGCTCTGG - Intergenic
1175960005 20:62631218-62631240 CCCTGCACTCTTGGGAGCCCGGG - Intergenic
1177331988 21:19677203-19677225 CACCACCATCTTGGGAGCTCTGG - Intergenic
1177531137 21:22359808-22359830 CACCACCATCTTGGGAGCTCTGG - Intergenic
1178247939 21:30972243-30972265 AGCTGCCATCTTGGGGGAGCTGG - Intergenic
1179259557 21:39745936-39745958 CACCACCATCTTGGGAGCTCTGG - Intronic
1180193984 21:46182687-46182709 CGCCGCCCTCCTGGCAGCTCTGG + Exonic
1180862056 22:19089158-19089180 CCCTGCCATCTTGCAAGTTCTGG + Intronic
1182221426 22:28761907-28761929 CACCACCATCTTGGGAGCTCTGG + Intergenic
1183290966 22:37001941-37001963 CGGTCCCAGCTTGGGGGCTCAGG - Exonic
1184042026 22:41949934-41949956 CCCTGCCAGCTTGGGTGTTCAGG - Intergenic
1184479333 22:44737741-44737763 CGCTCCCTTCTAGGGAGCGCAGG + Intronic
1184592726 22:45495932-45495954 CTCTGCCAGCATGGGAGCTGTGG - Intergenic
1185102847 22:48850765-48850787 CGGTGCCCTCTTGGGAGGTTTGG - Intronic
949531185 3:4957061-4957083 AGCTGCCATTCTGGGAGCTGGGG - Intergenic
949811615 3:8012621-8012643 TGCCACTATCTTGGGAGCTCTGG - Intergenic
950029271 3:9841394-9841416 AGCTGCCATCTTCTGAGCTCAGG + Intronic
951326014 3:21302794-21302816 CGCCGCCATCTTGGGAGCTCTGG - Intergenic
951837706 3:27001499-27001521 CGCCACTATCTTGGGAGCTCTGG + Intergenic
952921657 3:38289441-38289463 CGCCACCATCTTGGGAGCTCTGG - Intronic
952922639 3:38296566-38296588 TGCCACCATCTTGGGAGCTCTGG - Intronic
953505955 3:43485589-43485611 CGCCACCATCTTGGGAGCTCTGG + Intronic
956564300 3:70617823-70617845 TGCCACCATCTTGGGAGCTCGGG + Intergenic
957000446 3:74877603-74877625 TGCCACCATCTTGGGAGCTCTGG - Intergenic
957081454 3:75639273-75639295 TGCCACCATCTTGGGAGCTCTGG - Intergenic
957296854 3:78343909-78343931 CACCACCCTCTTGGGAGCTCTGG - Intergenic
957687101 3:83515655-83515677 TGCCACCGTCTTGGGAGCTCTGG + Intergenic
958016680 3:87945876-87945898 CGCCACCATCTTGGGAGCTCTGG - Intergenic
958629187 3:96666493-96666515 CACCACCATCTTGGGAGCTCTGG - Intergenic
958630310 3:96674712-96674734 CGCCACCATCTTGGGACCTCTGG - Intergenic
963915376 3:150854733-150854755 CACCACCATCTTGGGAGCTCTGG + Intergenic
965117952 3:164515516-164515538 CCCTGCACTCTTGGGAGCCCAGG - Intergenic
965342072 3:167503355-167503377 CGCCACCATCTTGGGAGCTCTGG - Intronic
965604623 3:170485916-170485938 GGCTGCCATCCAAGGAGCTCAGG - Intronic
966353331 3:179055059-179055081 CGCCGCCATCTTGGGAGCTCTGG + Intronic
967389093 3:188938201-188938223 CACCACCATCTTGGGAGCTCTGG - Intergenic
967623166 3:191659271-191659293 AACCACCATCTTGGGAGCTCTGG + Intergenic
968614050 4:1569409-1569431 GGCAGCCCTCTGGGGAGCTCAGG + Intergenic
969162680 4:5275157-5275179 TGCCACCATCTTGGGAGCTTTGG + Intronic
969644724 4:8421083-8421105 CACCACCATCTTGGGAGCTCTGG + Intronic
970095593 4:12459918-12459940 CACCACCATCTTGGGAGCTCTGG + Intergenic
970738055 4:19197801-19197823 CACCACCATCTTGGGAGCTCTGG - Intergenic
972766716 4:42158230-42158252 TGCCACCATCTTGGGAGCTCTGG - Intergenic
972853899 4:43082580-43082602 CACCACCATCTTGGGAGCTCTGG + Intergenic
973205009 4:47550508-47550530 CGCCACCATCTTGGGAGCTCTGG - Intronic
974190034 4:58493061-58493083 TGCCACCATCTTGGGAGCTCTGG - Intergenic
974487797 4:62526557-62526579 CGCCACCATCTTGGGAGCTCTGG - Intergenic
974520012 4:62971729-62971751 CACCACCATCTTGGGAGCTCTGG + Intergenic
974520820 4:62977716-62977738 TGCCGCCATCTTGGGAGCTCTGG + Intergenic
975783375 4:77862835-77862857 CGCCGCCATGTTGGGCACTCCGG - Exonic
976515163 4:85956428-85956450 CACCTCCATCTTGGGAGCTCTGG - Intronic
976963553 4:91008758-91008780 TGCCAACATCTTGGGAGCTCTGG - Intronic
977251375 4:94692962-94692984 CACCACCATCTTGGGAGCTCTGG + Intergenic
977487409 4:97666002-97666024 CTCTGCACTCTTGGGAGCCCAGG - Intronic
978527617 4:109681460-109681482 CACGACCATCTTGGGAGTTCTGG - Intronic
978909082 4:114044860-114044882 TGCCACCATCTTGGGAGCTCTGG + Intergenic
979910888 4:126364012-126364034 CACCACTATCTTGGGAGCTCTGG + Intergenic
980190584 4:129519691-129519713 CGCCACCATCTTGGAAGCTCTGG + Intergenic
980386249 4:132090431-132090453 CACCACCATCTTGGGAGCTCTGG - Intergenic
980443868 4:132882755-132882777 TGCCACCATCTTGGGAGCTCTGG + Intergenic
980871917 4:138621809-138621831 CACCACCATCTTGGGAGCTCTGG - Intergenic
981740812 4:147999774-147999796 GGTCACCATCTTGGGAGCTCTGG + Intronic
982107543 4:152024036-152024058 CACTGCCATTTTGGGAGTGCTGG - Intergenic
982847909 4:160275218-160275240 TGCTGGCAACTTGGGAACTCAGG - Intergenic
983777851 4:171630218-171630240 CGCCACCATCTTGGGAGCTCTGG + Intergenic
985449443 4:190051849-190051871 CGCCACCATCTTGGGCGCTCTGG + Intergenic
986918778 5:12660403-12660425 CGCTGCCATCTTGGGATCTCTGG - Intergenic
987508290 5:18800785-18800807 CACCACCATCTTGGGAGCTCTGG + Intergenic
987537626 5:19208643-19208665 CCCTGCCCTCTTGGGGGCCCGGG + Intergenic
987761124 5:22164124-22164146 CACGACCATCTTGGGAGCTCTGG - Intronic
987855186 5:23411618-23411640 TGCCACCATCTTGGGAGCTCTGG + Intergenic
988957337 5:36332618-36332640 CGCCATCATCTTGGGAGCTCTGG - Intergenic
989688068 5:44111824-44111846 CATCACCATCTTGGGAGCTCTGG + Intergenic
989688493 5:44115033-44115055 CACCACCATCTTGGGAGCTCTGG + Intergenic
989717755 5:44483832-44483854 CGCCACCATCTTGGGAGCTCTGG + Intergenic
990741429 5:58916259-58916281 CACCACCATCTTGGGAGCTCTGG + Intergenic
991290681 5:65031240-65031262 CGCCACCATCTTGGGAGCTCTGG + Intergenic
991561902 5:67962711-67962733 GGTGGCCATCCTGGGAGCTCTGG + Intergenic
991895916 5:71397578-71397600 CACCACCATCTTGGGAGCTCTGG - Intergenic
993054924 5:82970626-82970648 CACCACCATCTTGGGAGCTCTGG - Intergenic
993305716 5:86272681-86272703 CACCACCATCTTGGGAGCTCTGG - Intergenic
993591008 5:89794993-89795015 CACCACCATCTTGAGAGCTCTGG + Intergenic
993982393 5:94558251-94558273 CGCCACCATCTTGGGAGCTCTGG + Intronic
995465223 5:112444414-112444436 CACCACCATCTTGGGAGCTCTGG + Intergenic
995785024 5:115818772-115818794 TGCTGCCATCCTGGGAGCGGTGG - Intergenic
996321951 5:122228882-122228904 TGCCACCATCTTGGGCGCTCTGG - Intergenic
998039739 5:138944654-138944676 GGCTGCCATCCTGGGAACTGTGG - Intergenic
998122067 5:139586999-139587021 CACCACCATCTTGAGAGCTCTGG - Intronic
998127188 5:139632588-139632610 CACTGCCATCTTGGAAGGTGTGG + Intergenic
998644376 5:144045892-144045914 TGCCACCATCTTGGGAGCTCTGG + Intergenic
998666022 5:144298275-144298297 TGCCACCATCTTGGGAGCTCTGG + Intronic
999262528 5:150246581-150246603 GGCCGCCATTTTGTGAGCTCAGG + Intronic
1000095520 5:157967732-157967754 CGCCACCATCTTGGGAACTCTGG + Intergenic
1001235434 5:170025488-170025510 CTCTGCCATCTTGGGAAAGCTGG - Intronic
1001701215 5:173707734-173707756 TGCTGCCATGCTGAGAGCTCTGG - Intergenic
1002833033 6:841475-841497 GGCTGCCTTCTTAGGAGGTCGGG + Intergenic
1003278493 6:4672663-4672685 AGCATCAATCTTGGGAGCTCTGG + Intergenic
1004045962 6:12023098-12023120 GGCTGCCATCTTGGAACCTAAGG - Intronic
1005324074 6:24682314-24682336 CACAACCATCTTGGGAGCTCTGG - Intronic
1005816716 6:29558945-29558967 CACCACCATCTTGAGAGCTCTGG + Intronic
1005989770 6:30895627-30895649 AGCTTCCTCCTTGGGAGCTCAGG - Intronic
1007075368 6:39062712-39062734 GGCTGCTAACTTGGGACCTCCGG + Intronic
1007270499 6:40632541-40632563 CCCTTCCATCTTTGCAGCTCTGG - Intergenic
1008582715 6:52921177-52921199 TGCCACCATCTTGGGAGCTCTGG - Intergenic
1009519496 6:64663757-64663779 TGCTGCCATCTTGGGGGCTCTGG - Intronic
1009702518 6:67202054-67202076 TGCCACCATCTTGGGAGCTCTGG + Intergenic
1011813299 6:91158113-91158135 CCCTGCCCTGTTGGGAGGTCAGG + Intergenic
1013021810 6:106228595-106228617 CGCCACCATCTTCGGAGTTCTGG + Intronic
1013132893 6:107252039-107252061 GGCTGCCAGCCTGGAAGCTCTGG - Intronic
1013410566 6:109879940-109879962 CACCACCATCTTGGGAGCTCTGG + Intergenic
1013654235 6:112228691-112228713 AGCTGCCATCTTGGGAGTCATGG + Intronic
1013983137 6:116157382-116157404 CACTGCTATCTTGGAAGCTCAGG + Intronic
1014243405 6:119041998-119042020 CGCCACCATCTTGGGAGCTCTGG + Intronic
1014289175 6:119539252-119539274 TGCTGCCATCATGCGAGCTGCGG + Intergenic
1015632830 6:135248284-135248306 CGCCACTATCTTGGGAACTCTGG + Intergenic
1017868942 6:158469883-158469905 CACCACCATCTTGGGAGCTCTGG - Intronic
1018860227 6:167705880-167705902 CGCTGCCTTCTAGGAAGCTGGGG - Intergenic
1019614044 7:1950904-1950926 CACTGCCGTGGTGGGAGCTCAGG - Intronic
1020906278 7:14067573-14067595 TGCCACCATCTTGGGAGCTCTGG + Intergenic
1021885279 7:25131590-25131612 TGCCACCATCTTGGGAGCTCTGG - Intergenic
1022117720 7:27276828-27276850 TGCCACCATCTTGGGGGCTCTGG + Intergenic
1023094857 7:36650163-36650185 CACCACCGTCTTGGGAGCTCTGG + Intronic
1023733077 7:43210503-43210525 CAACACCATCTTGGGAGCTCTGG - Intronic
1024147960 7:46536450-46536472 CAACACCATCTTGGGAGCTCTGG - Intergenic
1024857125 7:53794914-53794936 CCCTGCATTCTTGGGAGCCCAGG - Intergenic
1027868303 7:83674746-83674768 CTCTGCCATCTTGGAAGCTCTGG - Intergenic
1028993449 7:97075153-97075175 TGCCACCATCTTGGGAGCTCTGG + Intergenic
1029016024 7:97316272-97316294 GGTGGCCATCCTGGGAGCTCTGG + Intergenic
1030215789 7:107042798-107042820 CGCTGCCAAAGTGGGAGCCCAGG + Intergenic
1030336875 7:108337789-108337811 CGCCACCATCTTGGGAGCTCTGG + Intronic
1030431310 7:109452518-109452540 TGCCACCATCTTGGGAGCTCTGG + Intergenic
1030661210 7:112221373-112221395 TGCCACCATCTCGGGAGCTCTGG + Intronic
1031299634 7:120047827-120047849 TGCCACCATCTTGGGAGCTCTGG + Intergenic
1031742766 7:125455583-125455605 CGCCACCATCTTGGGAGCTCTGG - Intergenic
1032653905 7:133907025-133907047 AGCCACCATCTTGGGAGCTCTGG + Intronic
1033471463 7:141653359-141653381 TGCTGCTATTTTGTGAGCTCCGG + Exonic
1034272348 7:149809318-149809340 CTCTCCCAGGTTGGGAGCTCAGG + Intergenic
1034650779 7:152688504-152688526 CGCCACCATCATGGGAGCTCTGG - Intergenic
1034964950 7:155385071-155385093 CGCCACCATCTTGGGAGCTCTGG - Intronic
1036571040 8:9980047-9980069 CCCTGCCATCATGGAGGCTCTGG - Intergenic
1036594740 8:10201404-10201426 AGCTGCCATCTTGGGAGTCCTGG - Intronic
1037123363 8:15316661-15316683 CGCGGCCATCGTGGGAGCTCTGG - Intergenic
1037170751 8:15888811-15888833 TGCTTCCATCTAGGCAGCTCTGG + Intergenic
1037648625 8:20816703-20816725 CACCACCATCTTGGGAGCTCTGG - Intergenic
1038742189 8:30225586-30225608 CACCACCATCTTGGGAGCTCTGG - Intergenic
1039666442 8:39536542-39536564 CGCTATCTTCTTTGGAGCTCTGG + Intergenic
1040768391 8:50943944-50943966 CGCCACCCTCTTGGGAGCTCTGG - Intergenic
1041357370 8:57014592-57014614 GCCTGCACTCTTGGGAGCTCGGG - Intergenic
1042196897 8:66238560-66238582 CCCTGCACTCTTGGGAGCCCAGG - Intergenic
1043432471 8:80208213-80208235 GATAGCCATCTTGGGAGCTCAGG - Intronic
1045657649 8:104403462-104403484 TGCCACCATCTTGGGAGCTCTGG + Intronic
1045788582 8:105955198-105955220 CACCACCATCTTGGGAGCTCTGG - Intergenic
1047599699 8:126413711-126413733 CACCACCATCTTGGGAGCTCTGG - Intergenic
1047618372 8:126581661-126581683 CGCCACCATCTTGGGAGCTCTGG + Intergenic
1048315262 8:133357008-133357030 TGCTGCCTTCTTAGGAGGTCTGG - Intergenic
1048631544 8:136247986-136248008 TGCCACCATCTTGGGAGCTCTGG + Intergenic
1049302843 8:141880733-141880755 TGCTGTCATGTTGTGAGCTCAGG - Intergenic
1049973901 9:843366-843388 CTCAGCCATTTTGAGAGCTCTGG + Intronic
1050087313 9:1979439-1979461 CTCTGCCATCTTGGGAACTATGG - Intergenic
1050115991 9:2264247-2264269 CGCCACCATCTTGGGAGCTCTGG - Intergenic
1051699128 9:19801059-19801081 GGCCACCATCTTGGGAGCTCTGG - Intergenic
1051870137 9:21727624-21727646 GTCCACCATCTTGGGAGCTCTGG + Intergenic
1051970117 9:22877736-22877758 CGCCACCATCTTGGGAGCTCTGG - Intergenic
1052056732 9:23914894-23914916 TGCTGCCATAGTGGGAGCCCAGG + Intergenic
1052854466 9:33398481-33398503 CGCTGCCATCTCTGTGGCTCAGG - Intronic
1053215252 9:36265349-36265371 CGCCACCATGTTGGGAGCTCTGG + Intronic
1054758543 9:68983372-68983394 CTCTGCCATCATAGGATCTCAGG - Intronic
1055049266 9:71963293-71963315 TGCCACCATCTTGGGAGCTCTGG - Intronic
1055431288 9:76246861-76246883 TGCCACCATCTTAGGAGCTCTGG - Intronic
1055455755 9:76469946-76469968 TGCCACCATCTTGGGAGCTCTGG + Intronic
1056177141 9:84045842-84045864 CCCTGCCATTTTGAGAGCCCAGG - Intergenic
1057023496 9:91718725-91718747 TGCTGCCATCTTGGGGGCGGTGG + Intronic
1058231894 9:102436488-102436510 CCACACCATCTTGGGAGCTCTGG - Intergenic
1059991635 9:119870763-119870785 TGCTGCCAAATTGGGAGCCCAGG + Intergenic
1062421066 9:136483020-136483042 CGCAGCCATCTTGGCACATCCGG + Intronic
1186254477 X:7703564-7703586 CGCCACCATCTTGGGATCTCTGG - Intergenic
1187613878 X:20972193-20972215 CGCCACCATCTTGGGAGCTCTGG + Intergenic
1189954213 X:46261640-46261662 CGCCACCATCTTGGGAGCTCTGG - Intergenic
1190099233 X:47508331-47508353 CTCTGCCATCTGTGGAGCTGTGG - Intergenic
1190240619 X:48655240-48655262 CACCACCATCTTGGGAGCTCTGG + Intergenic
1191167434 X:57405221-57405243 CGCCACCATCTTGGGAGCTCTGG - Intronic
1192317298 X:70062920-70062942 CGCCGCCATCCTGGGAGCCAGGG + Exonic
1192502488 X:71663115-71663137 AGCTGCCACCTTTGGAGCTCCGG - Intergenic
1192504263 X:71671385-71671407 AGCTGCTACCTTTGGAGCTCCGG + Intergenic
1192509691 X:71714491-71714513 AGCTGCCACCTTTGGAGCTCCGG - Exonic
1192517006 X:71767062-71767084 AGCTGCCACCTTTGGAGCTCCGG + Exonic
1192936809 X:75869088-75869110 CCCTGCCATCTTGGGTTCCCTGG - Intergenic
1193295429 X:79827207-79827229 CGCCACCATCTTGGGAGCTCTGG - Intergenic
1194103212 X:89734226-89734248 CACCACCATCTTGGGAACTCTGG - Intergenic
1194200710 X:90950590-90950612 CACCGCCATCTTGGGAGCTCTGG - Intergenic
1194445334 X:93981131-93981153 CACCACCATCTTGGGAGCTCTGG - Intergenic
1195256636 X:103097135-103097157 CACCACCATCTTGGGAGCTCTGG + Intergenic
1195505025 X:105646909-105646931 CACCACCATCTTGGGAGCTTTGG - Intronic
1195584660 X:106551719-106551741 CACCACCATCTTGGGAGCTCTGG + Intergenic
1196772470 X:119308838-119308860 TGCCACCATCTTGGGAGCTCTGG - Intergenic
1197545267 X:127816244-127816266 TGCCACCATCTTGGGAGCTCTGG - Intergenic
1197942439 X:131803583-131803605 CCCTGCCTTCTTGGGAGCTGTGG + Intergenic
1197972438 X:132129623-132129645 TGCTGCTATTTTGAGAGCTCCGG - Intergenic
1198862388 X:141084644-141084666 TGCCGCCATCTTGGTAGCTCTGG + Intergenic
1198900306 X:141502742-141502764 TGCCGCCATCTTGGTAGCTCTGG - Intergenic
1199268727 X:145858161-145858183 CGCCACCATCTTGGGAGCTCTGG - Intergenic
1200546700 Y:4527023-4527045 CACCGCCATCTTGGGAGCTCTGG - Intergenic
1200762739 Y:7054945-7054967 TGCCACCATCTTGGGAGCTCTGG + Intronic
1201500828 Y:14640801-14640823 TGCTGCTATTTTGTGAGCTCTGG + Intronic
1201581978 Y:15519198-15519220 CCCTACCATCTTGGGAGCTCTGG - Intergenic
1202062426 Y:20901162-20901184 CGCCACCATCTTGGGAGCTCTGG + Intergenic