ID: 1117172312

View in Genome Browser
Species Human (GRCh38)
Location 14:53113581-53113603
Sequence GAGAGTGAGCAGAAGCATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2069
Summary {0: 1, 1: 21, 2: 191, 3: 590, 4: 1266}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117172305_1117172312 10 Left 1117172305 14:53113548-53113570 CCCCGTTCATTTCATTGGAAAAA 0: 1
1: 0
2: 3
3: 18
4: 312
Right 1117172312 14:53113581-53113603 GAGAGTGAGCAGAAGCATGGTGG 0: 1
1: 21
2: 191
3: 590
4: 1266
1117172303_1117172312 22 Left 1117172303 14:53113536-53113558 CCAACTGAGGTGCCCCGTTCATT 0: 1
1: 0
2: 21
3: 435
4: 2470
Right 1117172312 14:53113581-53113603 GAGAGTGAGCAGAAGCATGGTGG 0: 1
1: 21
2: 191
3: 590
4: 1266
1117172306_1117172312 9 Left 1117172306 14:53113549-53113571 CCCGTTCATTTCATTGGAAAAAT 0: 1
1: 0
2: 3
3: 41
4: 410
Right 1117172312 14:53113581-53113603 GAGAGTGAGCAGAAGCATGGTGG 0: 1
1: 21
2: 191
3: 590
4: 1266
1117172307_1117172312 8 Left 1117172307 14:53113550-53113572 CCGTTCATTTCATTGGAAAAATG 0: 1
1: 0
2: 6
3: 40
4: 511
Right 1117172312 14:53113581-53113603 GAGAGTGAGCAGAAGCATGGTGG 0: 1
1: 21
2: 191
3: 590
4: 1266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117172312 Original CRISPR GAGAGTGAGCAGAAGCATGG TGG Intronic
Too many off-targets to display for this crispr