ID: 1117176448

View in Genome Browser
Species Human (GRCh38)
Location 14:53152022-53152044
Sequence CCTTCGGGGGTAGCGCCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 47}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117176448_1117176458 9 Left 1117176448 14:53152022-53152044 CCAGGAGGCGCTACCCCCGAAGG 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1117176458 14:53152054-53152076 CTCCTGACCCCAGGCAGCTTGGG 0: 1
1: 0
2: 1
3: 32
4: 339
1117176448_1117176454 0 Left 1117176448 14:53152022-53152044 CCAGGAGGCGCTACCCCCGAAGG 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1117176454 14:53152045-53152067 TATCCAGTCCTCCTGACCCCAGG 0: 1
1: 0
2: 1
3: 20
4: 224
1117176448_1117176457 8 Left 1117176448 14:53152022-53152044 CCAGGAGGCGCTACCCCCGAAGG 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1117176457 14:53152053-53152075 CCTCCTGACCCCAGGCAGCTTGG 0: 1
1: 0
2: 5
3: 54
4: 440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117176448 Original CRISPR CCTTCGGGGGTAGCGCCTCC TGG (reversed) Intronic