ID: 1117178080

View in Genome Browser
Species Human (GRCh38)
Location 14:53165584-53165606
Sequence TCCCTCTGGCTCCACTATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117178077_1117178080 3 Left 1117178077 14:53165558-53165580 CCTTGCCAAGAGCATGGTCTTCT No data
Right 1117178080 14:53165584-53165606 TCCCTCTGGCTCCACTATCCAGG No data
1117178073_1117178080 24 Left 1117178073 14:53165537-53165559 CCCTCCTGATATTGGTGGTGGCC No data
Right 1117178080 14:53165584-53165606 TCCCTCTGGCTCCACTATCCAGG No data
1117178074_1117178080 23 Left 1117178074 14:53165538-53165560 CCTCCTGATATTGGTGGTGGCCT No data
Right 1117178080 14:53165584-53165606 TCCCTCTGGCTCCACTATCCAGG No data
1117178075_1117178080 20 Left 1117178075 14:53165541-53165563 CCTGATATTGGTGGTGGCCTTGC No data
Right 1117178080 14:53165584-53165606 TCCCTCTGGCTCCACTATCCAGG No data
1117178078_1117178080 -2 Left 1117178078 14:53165563-53165585 CCAAGAGCATGGTCTTCTGATTC No data
Right 1117178080 14:53165584-53165606 TCCCTCTGGCTCCACTATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117178080 Original CRISPR TCCCTCTGGCTCCACTATCC AGG Intergenic
No off target data available for this crispr