ID: 1117187687

View in Genome Browser
Species Human (GRCh38)
Location 14:53258009-53258031
Sequence CTAGTTCAAAGCTTATTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117187687_1117187688 7 Left 1117187687 14:53258009-53258031 CCTTTAAATAAGCTTTGAACTAG No data
Right 1117187688 14:53258039-53258061 TTGTCCACCTTTTTTTTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117187687 Original CRISPR CTAGTTCAAAGCTTATTTAA AGG (reversed) Intergenic
No off target data available for this crispr