ID: 1117190387

View in Genome Browser
Species Human (GRCh38)
Location 14:53284674-53284696
Sequence ACATAAGGACAAAAGTAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117190384_1117190387 -1 Left 1117190384 14:53284652-53284674 CCAGGGTTAGATTCCAAAGGTAA No data
Right 1117190387 14:53284674-53284696 ACATAAGGACAAAAGTAATGAGG No data
1117190382_1117190387 11 Left 1117190382 14:53284640-53284662 CCTAATACTATTCCAGGGTTAGA No data
Right 1117190387 14:53284674-53284696 ACATAAGGACAAAAGTAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117190387 Original CRISPR ACATAAGGACAAAAGTAATG AGG Intergenic
No off target data available for this crispr