ID: 1117198798

View in Genome Browser
Species Human (GRCh38)
Location 14:53366776-53366798
Sequence ACTGAGACGCTGACTTTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117198786_1117198798 20 Left 1117198786 14:53366733-53366755 CCCTCCCATCTGGAGAGATCTTG No data
Right 1117198798 14:53366776-53366798 ACTGAGACGCTGACTTTGGAGGG No data
1117198787_1117198798 19 Left 1117198787 14:53366734-53366756 CCTCCCATCTGGAGAGATCTTGG No data
Right 1117198798 14:53366776-53366798 ACTGAGACGCTGACTTTGGAGGG No data
1117198790_1117198798 16 Left 1117198790 14:53366737-53366759 CCCATCTGGAGAGATCTTGGGCT No data
Right 1117198798 14:53366776-53366798 ACTGAGACGCTGACTTTGGAGGG No data
1117198791_1117198798 15 Left 1117198791 14:53366738-53366760 CCATCTGGAGAGATCTTGGGCTA No data
Right 1117198798 14:53366776-53366798 ACTGAGACGCTGACTTTGGAGGG No data
1117198785_1117198798 28 Left 1117198785 14:53366725-53366747 CCTACACACCCTCCCATCTGGAG No data
Right 1117198798 14:53366776-53366798 ACTGAGACGCTGACTTTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117198798 Original CRISPR ACTGAGACGCTGACTTTGGA GGG Intergenic
No off target data available for this crispr