ID: 1117199297

View in Genome Browser
Species Human (GRCh38)
Location 14:53372007-53372029
Sequence AAGAATATAAAGATGGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117199295_1117199297 30 Left 1117199295 14:53371954-53371976 CCATATTGAATGGGAGATTTGGT No data
Right 1117199297 14:53372007-53372029 AAGAATATAAAGATGGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117199297 Original CRISPR AAGAATATAAAGATGGAAAA AGG Intergenic
No off target data available for this crispr