ID: 1117201588

View in Genome Browser
Species Human (GRCh38)
Location 14:53395262-53395284
Sequence GGATTCTGTTGTTCAGCAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117201587_1117201588 -8 Left 1117201587 14:53395247-53395269 CCAGGTCAAGGAGTTGGATTCTG No data
Right 1117201588 14:53395262-53395284 GGATTCTGTTGTTCAGCAACTGG No data
1117201585_1117201588 1 Left 1117201585 14:53395238-53395260 CCTTTTATGCCAGGTCAAGGAGT No data
Right 1117201588 14:53395262-53395284 GGATTCTGTTGTTCAGCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117201588 Original CRISPR GGATTCTGTTGTTCAGCAAC TGG Intergenic
No off target data available for this crispr