ID: 1117205718

View in Genome Browser
Species Human (GRCh38)
Location 14:53441246-53441268
Sequence GAGATGTACCATTCCTGCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117205718_1117205719 5 Left 1117205718 14:53441246-53441268 CCTAGGCAGGAATGGTACATCTC No data
Right 1117205719 14:53441274-53441296 TAGTTCATTTAACTATATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117205718 Original CRISPR GAGATGTACCATTCCTGCCT AGG (reversed) Intergenic
No off target data available for this crispr