ID: 1117205971

View in Genome Browser
Species Human (GRCh38)
Location 14:53443979-53444001
Sequence TGCCATTGGGGGATGCTAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117205964_1117205971 0 Left 1117205964 14:53443956-53443978 CCAACTGGCTCCCTATGAGGCTT No data
Right 1117205971 14:53443979-53444001 TGCCATTGGGGGATGCTAAATGG No data
1117205966_1117205971 -10 Left 1117205966 14:53443966-53443988 CCCTATGAGGCTTTGCCATTGGG No data
Right 1117205971 14:53443979-53444001 TGCCATTGGGGGATGCTAAATGG No data
1117205961_1117205971 22 Left 1117205961 14:53443934-53443956 CCTTGCAAACAAGTTGGCTTTGC No data
Right 1117205971 14:53443979-53444001 TGCCATTGGGGGATGCTAAATGG No data
1117205960_1117205971 23 Left 1117205960 14:53443933-53443955 CCCTTGCAAACAAGTTGGCTTTG No data
Right 1117205971 14:53443979-53444001 TGCCATTGGGGGATGCTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117205971 Original CRISPR TGCCATTGGGGGATGCTAAA TGG Intergenic
No off target data available for this crispr