ID: 1117208572

View in Genome Browser
Species Human (GRCh38)
Location 14:53470823-53470845
Sequence AGAGAGAGCACAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117208572_1117208579 20 Left 1117208572 14:53470823-53470845 CCCACAATCACTGTGCTCTCTCT No data
Right 1117208579 14:53470866-53470888 CCATGCCACACCATTGTTGCTGG No data
1117208572_1117208581 22 Left 1117208572 14:53470823-53470845 CCCACAATCACTGTGCTCTCTCT No data
Right 1117208581 14:53470868-53470890 ATGCCACACCATTGTTGCTGGGG No data
1117208572_1117208583 24 Left 1117208572 14:53470823-53470845 CCCACAATCACTGTGCTCTCTCT No data
Right 1117208583 14:53470870-53470892 GCCACACCATTGTTGCTGGGGGG No data
1117208572_1117208582 23 Left 1117208572 14:53470823-53470845 CCCACAATCACTGTGCTCTCTCT No data
Right 1117208582 14:53470869-53470891 TGCCACACCATTGTTGCTGGGGG No data
1117208572_1117208586 28 Left 1117208572 14:53470823-53470845 CCCACAATCACTGTGCTCTCTCT No data
Right 1117208586 14:53470874-53470896 CACCATTGTTGCTGGGGGGTGGG No data
1117208572_1117208585 27 Left 1117208572 14:53470823-53470845 CCCACAATCACTGTGCTCTCTCT No data
Right 1117208585 14:53470873-53470895 ACACCATTGTTGCTGGGGGGTGG No data
1117208572_1117208589 30 Left 1117208572 14:53470823-53470845 CCCACAATCACTGTGCTCTCTCT No data
Right 1117208589 14:53470876-53470898 CCATTGTTGCTGGGGGGTGGGGG No data
1117208572_1117208587 29 Left 1117208572 14:53470823-53470845 CCCACAATCACTGTGCTCTCTCT No data
Right 1117208587 14:53470875-53470897 ACCATTGTTGCTGGGGGGTGGGG No data
1117208572_1117208580 21 Left 1117208572 14:53470823-53470845 CCCACAATCACTGTGCTCTCTCT No data
Right 1117208580 14:53470867-53470889 CATGCCACACCATTGTTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117208572 Original CRISPR AGAGAGAGCACAGTGATTGT GGG (reversed) Intergenic
No off target data available for this crispr