ID: 1117210067

View in Genome Browser
Species Human (GRCh38)
Location 14:53487858-53487880
Sequence TCAAGTAATGTAATGCTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117210067_1117210069 26 Left 1117210067 14:53487858-53487880 CCTGGAAGCATTACATTACTTGA No data
Right 1117210069 14:53487907-53487929 TAGCCAAACCAATATGGTACTGG No data
1117210067_1117210068 20 Left 1117210067 14:53487858-53487880 CCTGGAAGCATTACATTACTTGA No data
Right 1117210068 14:53487901-53487923 CTAATATAGCCAAACCAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117210067 Original CRISPR TCAAGTAATGTAATGCTTCC AGG (reversed) Intergenic
No off target data available for this crispr