ID: 1117210069

View in Genome Browser
Species Human (GRCh38)
Location 14:53487907-53487929
Sequence TAGCCAAACCAATATGGTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117210067_1117210069 26 Left 1117210067 14:53487858-53487880 CCTGGAAGCATTACATTACTTGA No data
Right 1117210069 14:53487907-53487929 TAGCCAAACCAATATGGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117210069 Original CRISPR TAGCCAAACCAATATGGTAC TGG Intergenic
No off target data available for this crispr