ID: 1117211569

View in Genome Browser
Species Human (GRCh38)
Location 14:53506335-53506357
Sequence GCCACTGCTGTGTCCTAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117211566_1117211569 22 Left 1117211566 14:53506290-53506312 CCAGTTGGATTCTAGAGCGCACA No data
Right 1117211569 14:53506335-53506357 GCCACTGCTGTGTCCTAAGCAGG No data
1117211567_1117211569 -8 Left 1117211567 14:53506320-53506342 CCACTGTCCTTTATTGCCACTGC No data
Right 1117211569 14:53506335-53506357 GCCACTGCTGTGTCCTAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117211569 Original CRISPR GCCACTGCTGTGTCCTAAGC AGG Intergenic
No off target data available for this crispr