ID: 1117213468

View in Genome Browser
Species Human (GRCh38)
Location 14:53526055-53526077
Sequence GGTCTAGCCCGCAGGGCGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117213468_1117213473 9 Left 1117213468 14:53526055-53526077 CCAAGCGCCCTGCGGGCTAGACC No data
Right 1117213473 14:53526087-53526109 CTGCAGAACCAGCATGAACCAGG No data
1117213468_1117213474 10 Left 1117213468 14:53526055-53526077 CCAAGCGCCCTGCGGGCTAGACC No data
Right 1117213474 14:53526088-53526110 TGCAGAACCAGCATGAACCAGGG No data
1117213468_1117213475 14 Left 1117213468 14:53526055-53526077 CCAAGCGCCCTGCGGGCTAGACC No data
Right 1117213475 14:53526092-53526114 GAACCAGCATGAACCAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117213468 Original CRISPR GGTCTAGCCCGCAGGGCGCT TGG (reversed) Intergenic
No off target data available for this crispr