ID: 1117213470

View in Genome Browser
Species Human (GRCh38)
Location 14:53526062-53526084
Sequence TGCCAGAGGTCTAGCCCGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117213470_1117213475 7 Left 1117213470 14:53526062-53526084 CCCTGCGGGCTAGACCTCTGGCA No data
Right 1117213475 14:53526092-53526114 GAACCAGCATGAACCAGGGCAGG No data
1117213470_1117213478 24 Left 1117213470 14:53526062-53526084 CCCTGCGGGCTAGACCTCTGGCA No data
Right 1117213478 14:53526109-53526131 GGCAGGTAGTGAACACCGAGAGG No data
1117213470_1117213473 2 Left 1117213470 14:53526062-53526084 CCCTGCGGGCTAGACCTCTGGCA No data
Right 1117213473 14:53526087-53526109 CTGCAGAACCAGCATGAACCAGG No data
1117213470_1117213479 25 Left 1117213470 14:53526062-53526084 CCCTGCGGGCTAGACCTCTGGCA No data
Right 1117213479 14:53526110-53526132 GCAGGTAGTGAACACCGAGAGGG No data
1117213470_1117213474 3 Left 1117213470 14:53526062-53526084 CCCTGCGGGCTAGACCTCTGGCA No data
Right 1117213474 14:53526088-53526110 TGCAGAACCAGCATGAACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117213470 Original CRISPR TGCCAGAGGTCTAGCCCGCA GGG (reversed) Intergenic
No off target data available for this crispr