ID: 1117213473

View in Genome Browser
Species Human (GRCh38)
Location 14:53526087-53526109
Sequence CTGCAGAACCAGCATGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117213468_1117213473 9 Left 1117213468 14:53526055-53526077 CCAAGCGCCCTGCGGGCTAGACC No data
Right 1117213473 14:53526087-53526109 CTGCAGAACCAGCATGAACCAGG No data
1117213470_1117213473 2 Left 1117213470 14:53526062-53526084 CCCTGCGGGCTAGACCTCTGGCA No data
Right 1117213473 14:53526087-53526109 CTGCAGAACCAGCATGAACCAGG No data
1117213471_1117213473 1 Left 1117213471 14:53526063-53526085 CCTGCGGGCTAGACCTCTGGCAC No data
Right 1117213473 14:53526087-53526109 CTGCAGAACCAGCATGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117213473 Original CRISPR CTGCAGAACCAGCATGAACC AGG Intergenic
No off target data available for this crispr