ID: 1117216839

View in Genome Browser
Species Human (GRCh38)
Location 14:53560147-53560169
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 842
Summary {0: 180, 1: 172, 2: 120, 3: 86, 4: 284}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117216839_1117216844 16 Left 1117216839 14:53560147-53560169 CCCTGCCATCTTCTGCAGATAAC 0: 180
1: 172
2: 120
3: 86
4: 284
Right 1117216844 14:53560186-53560208 GACACCTCTTGGCCTGTTACTGG No data
1117216839_1117216845 17 Left 1117216839 14:53560147-53560169 CCCTGCCATCTTCTGCAGATAAC 0: 180
1: 172
2: 120
3: 86
4: 284
Right 1117216845 14:53560187-53560209 ACACCTCTTGGCCTGTTACTGGG No data
1117216839_1117216842 5 Left 1117216839 14:53560147-53560169 CCCTGCCATCTTCTGCAGATAAC 0: 180
1: 172
2: 120
3: 86
4: 284
Right 1117216842 14:53560175-53560197 TCCTTTTGAGAGACACCTCTTGG No data
1117216839_1117216847 26 Left 1117216839 14:53560147-53560169 CCCTGCCATCTTCTGCAGATAAC 0: 180
1: 172
2: 120
3: 86
4: 284
Right 1117216847 14:53560196-53560218 GGCCTGTTACTGGGCTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117216839 Original CRISPR GTTATCTGCAGAAGATGGCA GGG (reversed) Intergenic
900434957 1:2625575-2625597 GTTAACTGCAGAAGATAGCAGGG - Intronic
901444624 1:9300521-9300543 GTTATTTGTGGATGATGGCAGGG - Intronic
901904053 1:12392687-12392709 GTTATCTGCAGAAGATGGCAGGG + Intronic
901923416 1:12551772-12551794 GTTCTACACAGAAGATGGCATGG + Intergenic
904179495 1:28655974-28655996 GTTATCTGCAGAAGATGGCAGGG + Intergenic
904335930 1:29797983-29798005 GTTATCTGCAGAAGATGGCAGGG - Intergenic
904372989 1:30062373-30062395 GTTATCTACAGAAGAGGATAGGG - Intergenic
904452882 1:30627691-30627713 GTTATCTACAGAACAGTGCAGGG + Intergenic
904889388 1:33767561-33767583 GTTAGCTGCATAAGAGGGTATGG - Intronic
905029653 1:34873310-34873332 GTTATCTGCTGGAGATGTCTGGG + Intronic
905354065 1:37368784-37368806 GTTATCTGCAGAAGATGGCAGGG - Intergenic
905465223 1:38148096-38148118 GTTATCTGAAGAAGATGGTAGGG - Intergenic
905624596 1:39479969-39479991 GGTGGCTGGAGAAGATGGCATGG - Exonic
906050486 1:42867411-42867433 ATTATCTGCAGAAGATGGCAGGG - Intergenic
906159780 1:43639488-43639510 CTTCTCTGCAGAGGATGGCTTGG - Intergenic
906879673 1:49576459-49576481 GTTATGTGCAGAAAATGGCAGGG - Intronic
907545719 1:55258361-55258383 GTTTGCTGCTGAAGATGGCTGGG + Intergenic
907597344 1:55732127-55732149 GTTATCTGCAGAAGATGACAGGG - Intergenic
907602085 1:55782150-55782172 GTTATCTGTAGATGATGGCAGGG + Intergenic
908148382 1:61272576-61272598 GTACTCTGCAGAAGAGGCCAAGG - Intronic
908848649 1:68350950-68350972 GGTATTGGCAGAAGAGGGCAAGG - Intergenic
909324618 1:74334690-74334712 GTTAAATGGAGAAGATGCCAGGG + Intronic
909471912 1:76038997-76039019 GTTGTCTGCAGGAGAAAGCAGGG + Intergenic
909576918 1:77185855-77185877 GTTATCTGCAGAAGATGGCAGGG - Intronic
909706592 1:78592189-78592211 GTCATCTGCAGAAGAAGGAATGG + Intergenic
910370632 1:86512125-86512147 GTTATCTGCAGAAGATGGCAGGG - Intergenic
910561898 1:88599978-88600000 GTTATCTGCAGAAGATGGCAGGG - Intergenic
910565675 1:88640075-88640097 GTTATCTGAGAATGATGGCAGGG + Intergenic
910588214 1:88901723-88901745 ATTATCTGCAGAAGATGGCAGGG - Intergenic
910630218 1:89346249-89346271 GTTATCTGCAAAAGATGGCAGGG - Intergenic
910638993 1:89439977-89439999 ATTATCTGCAGAAGATGGCAGGG + Intergenic
910831100 1:91463427-91463449 GTTGTCTGCAAAAGATGGCAGGG + Intergenic
910948212 1:92616685-92616707 GTTATCTGAAGAAGATGGCAGGG - Intronic
911109100 1:94164208-94164230 GTTATCTTCAGAAGATGGCAGGG + Intronic
911143430 1:94530201-94530223 GTTATGTGCAAAAGGTGCCATGG + Exonic
911221620 1:95253207-95253229 ATTATTTGCAGAAGAGGGCATGG + Intergenic
911257328 1:95647367-95647389 GTTATCTGCAGAAGATGGCAGGG + Intergenic
911738400 1:101361922-101361944 GTTATCTGCAGAAGATGGCAGGG + Intergenic
911883568 1:103270446-103270468 GTTATAGGCAGAAGATGGCAGGG - Intergenic
911980424 1:104559418-104559440 GTTATCTGCAGAAGATGGCAGGG - Intergenic
911981901 1:104579265-104579287 GTTATCTGCAAAGTATGGCAGGG + Intergenic
912055308 1:105589781-105589803 GCAATCTGCAGAAAATGGAAGGG + Intergenic
912067020 1:105756944-105756966 GTTATATGCAGAAGAAGGCAGGG - Intergenic
912129914 1:106588053-106588075 GTTATCTGCAGAAGATGGCAGGG + Intergenic
912212250 1:107568891-107568913 GTTATCTGCAGAAGATGGCAGGG - Intergenic
912252032 1:108021391-108021413 GTTATCTGCAGAAGATGGCAGGG + Intergenic
912733325 1:112128832-112128854 GTCATCTGCAGAAGATGGCAGGG + Intergenic
913039447 1:115008398-115008420 GTTATCTACAGAAGATAGCAGGG + Intergenic
913474118 1:119220250-119220272 ATTATCTTCAGAAGATGCTAGGG - Intergenic
913530741 1:119732648-119732670 TTTATCTGCAGATGACTGCAGGG - Intronic
915234481 1:154470358-154470380 GATTTCTGTAGAGGATGGCAAGG + Intronic
915625079 1:157109493-157109515 GTTAGCTGCAGAAGATGCCAAGG + Intergenic
915667672 1:157459646-157459668 GTCATCTGCCAAAGATGGCAAGG + Intergenic
916002244 1:160628239-160628261 GTTCTCTGCTGAAGATTGAAGGG + Intronic
916106332 1:161435330-161435352 GTTATTTGCAGAAGATGGCAGGG + Intergenic
916285314 1:163099525-163099547 GTTATTTGCAGAAGATCGGAGGG - Intergenic
916365973 1:164028090-164028112 GTTATCTGTGGAGGAGGGCAGGG + Intergenic
916709175 1:167387103-167387125 GTTCTCTGCATATGGTGGCAGGG + Intronic
917217217 1:172690916-172690938 GTTATCTGCAGAAGATGGCAGGG + Intergenic
918755718 1:188337812-188337834 GTTATCTGGAGAAGATGGAAGGG + Intergenic
918774491 1:188610744-188610766 GTCATTTGCTGAAGATGGAAGGG - Intergenic
918815076 1:189171225-189171247 GTTACCTGCAGAAGATGGCTGGG - Intergenic
918918234 1:190671882-190671904 GTTATCTGCAGAAGATGGCAGGG + Intergenic
918958241 1:191237946-191237968 GTTGTCTTCAGAAGATGGCAGGG - Intergenic
919124614 1:193379784-193379806 GTTATCTACAGAAGATGGCAGGG + Intergenic
919220455 1:194621688-194621710 GTTATCTGCAGAAGTGTGCATGG + Intergenic
920197428 1:204238363-204238385 GTTAGCTGCAGAAGATGGCAGGG - Intronic
922781049 1:228252584-228252606 GTTATCTGCAGAAGATGACAGGG + Intronic
923253571 1:232199440-232199462 GTTATCTGCAGAAGATAGCAGGG + Intergenic
924182509 1:241453248-241453270 GTTATTTGCAGAAGATAGCAGGG + Intergenic
924432244 1:244007187-244007209 ATTCTCTGCTGCAGATGGCATGG - Intergenic
924840779 1:247707835-247707857 GTTATCTGCAGAAGATGGCAGGG + Intergenic
924847136 1:247785141-247785163 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1063727241 10:8651372-8651394 TTTGTCTGCAGATGATGGTAGGG - Intergenic
1064517645 10:16168259-16168281 GTTATCTGCAGAAGAGGGCAGGG + Intergenic
1064545691 10:16448138-16448160 GTTATCTGCAGAAGATGGCAGGG + Intronic
1065005323 10:21374161-21374183 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1065607015 10:27428504-27428526 GTTATCCACTGAGGATGGCAGGG - Intergenic
1065711952 10:28526873-28526895 GTTATGAGCAGAAAATGACATGG - Intergenic
1066167030 10:32799233-32799255 ATTATCTGCAGAAGACGGCAGGG + Intronic
1066957620 10:42188050-42188072 GTTAACTGGAGAAGATGACCGGG - Intergenic
1067026696 10:42848357-42848379 GTTATCTGCTGAGGATGGCAGGG + Intergenic
1067125556 10:43512547-43512569 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1067333137 10:45340214-45340236 GTTATATGCAGAAAATGGCAGGG - Intergenic
1067529709 10:47061304-47061326 GTTAGCTGCAGAAGCCGGGAGGG - Intergenic
1068007720 10:51409879-51409901 GTTATCTGCAGAAGATGTCAGGG + Intronic
1068447207 10:57138590-57138612 GTTATCTGAAGAAGATGGCAGGG - Intergenic
1069145759 10:64890436-64890458 TTTATCTGCGGAAGATGGTAGGG - Intergenic
1069790834 10:71019586-71019608 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1069951856 10:72024518-72024540 CTTCTCTGCAGAAAAGGGCACGG - Intergenic
1070462822 10:76686973-76686995 GTGATATACAGAAGATGTCAGGG + Intergenic
1071267089 10:83974005-83974027 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1071364471 10:84884524-84884546 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1071673930 10:87637432-87637454 GTTATCTTCAGAAGATGGTAGGG + Intergenic
1071937686 10:90549273-90549295 GTTATCTGCAGAAGATGGAAGGG - Intergenic
1071942788 10:90607781-90607803 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1072209260 10:93231681-93231703 GTTATCTACAGAAGATGGCAAGG + Intergenic
1073182605 10:101594096-101594118 GAGATATGCAGAAGAAGGCAGGG + Intronic
1073656682 10:105424486-105424508 GTTATCTGCAGAAGATGTCAGGG + Intergenic
1073830507 10:107378012-107378034 GTTATCTGTAGATGATGGCAGGG + Intergenic
1073918479 10:108432318-108432340 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1073957687 10:108891656-108891678 GTTATCTGCAGAAGATGGTAGGG + Intergenic
1074479938 10:113810029-113810051 GGTATCTGGAGTACATGGCAGGG + Intergenic
1075606786 10:123817396-123817418 ATTATTTGCAGAAGATGGCAGGG - Intronic
1076772632 10:132674842-132674864 GTTACCTGCAGAAGATGGCAGGG + Intronic
1076927418 10:133499229-133499251 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1077381071 11:2237900-2237922 GTTATCTGTGGATGGTGGCAGGG - Intergenic
1077396474 11:2325981-2326003 GTTATCTGTGGATGATGACAGGG - Intergenic
1077846949 11:6035759-6035781 GTTATGTTCAGAAGATGGTGGGG - Intergenic
1078056207 11:8010936-8010958 GTTCTCTGCTGCAGAAGGCAGGG + Intergenic
1080076589 11:28157492-28157514 GTTATCTGCAGAAGATGTCAGGG - Intronic
1080976677 11:37350569-37350591 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1081065465 11:38534905-38534927 GTTGTCTGCAGGAGATGGCAGGG + Intergenic
1081072773 11:38631092-38631114 GATGTCTGCAGAAGATGGCAGGG - Intergenic
1081110474 11:39128390-39128412 GTTATCTGCATAAGATGGCAGGG - Intergenic
1081609058 11:44547849-44547871 GTTATCTGTAGAAGATGGCAGGG - Intergenic
1082671697 11:56043013-56043035 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1082999657 11:59279853-59279875 AGTATCTGCAGAAGATGGCAGGG - Intergenic
1083093142 11:60221098-60221120 GTTATCTGCAGAAGATGGCAGGG - Intronic
1083112259 11:60422850-60422872 GTTATCTGAAGAGGATGGAAGGG + Intergenic
1085685959 11:78622161-78622183 CTTATCTGCAGAAGATGGCAGGG - Intergenic
1085747568 11:79128211-79128233 GTTATCTGCAGAAGATGCCAGGG - Intronic
1086399727 11:86450553-86450575 GTTATCTGCAAAAGAGAGCATGG - Intronic
1086834111 11:91600364-91600386 GTTATCTGCAGAAGATGGCAAGG - Intergenic
1087153257 11:94877521-94877543 GTAATGTGCAAAAGATGGCAGGG + Intergenic
1087418795 11:97893766-97893788 GACATGTGCAGCAGATGGCATGG - Intergenic
1088191663 11:107234519-107234541 GTTATCTGCAGAATATGGCAGGG + Intergenic
1088449351 11:109965339-109965361 GTTATCTGTGGAAGATGGCAGGG - Intergenic
1088836652 11:113583360-113583382 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1089121673 11:116140024-116140046 GTTATCAGCAGAACAAGGCCTGG - Intergenic
1089390697 11:118099685-118099707 GCAATCTGCAGAAGATGGGAAGG - Intronic
1089762343 11:120737139-120737161 GTTATCTCCTGAGGATGGCCGGG + Intronic
1089876341 11:121725290-121725312 CTTATCTGCAGAGGATGGAGAGG - Intergenic
1090209496 11:124908076-124908098 GTCATCTGCAGAAGATGGCAGGG + Intergenic
1090221618 11:125031614-125031636 GTTATCTGCAGAAGATGGCAGGG + Intronic
1090537783 11:127663754-127663776 CTTACCGGCAGAAGAAGGCACGG + Intergenic
1090873209 11:130766325-130766347 GTGATCTGCAGGGGAAGGCAGGG - Intergenic
1091947787 12:4563816-4563838 GTACTCTGCAGAGGATAGCAAGG + Intronic
1092012419 12:5125630-5125652 GCTATCTGCAAAAAAAGGCAGGG + Intergenic
1092093280 12:5821622-5821644 GTTATCTGCAGAAGATGGCAGGG - Intronic
1092381557 12:8000910-8000932 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1093031874 12:14295978-14296000 GTTATCTGCGGAAGATGGCAGGG + Intergenic
1093036285 12:14335314-14335336 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1093048927 12:14484996-14485018 GTTACCTGCAAAAGATGGCAGGG + Intronic
1093049673 12:14490991-14491013 GTTACCTGCAAAAGATGACAGGG + Intronic
1093341119 12:17975016-17975038 GTTATCTGCAACAGAGGGCATGG + Intergenic
1093645724 12:21583642-21583664 GTTATCTGCAGAAGATGGCAGGG - Intronic
1093964535 12:25310928-25310950 GTTATCTGCAGAAGACGGCAGGG - Intergenic
1094102525 12:26779234-26779256 GTTATCTGCAGAAGATGGCAGGG - Intronic
1094819395 12:34212698-34212720 GTTATCTGCAGATAATGGCAGGG - Intergenic
1095048071 12:37532682-37532704 GATGTCAGCAGAAAATGGCAGGG - Intergenic
1095095415 12:38145376-38145398 GTTATCTGCAGATAATGGCAGGG + Intergenic
1095121509 12:38424872-38424894 GTTTTCTGCAGAAAATGCCAGGG + Intergenic
1095442986 12:42256423-42256445 ATTATTTGCAGAAAAGGGCATGG + Intronic
1095603851 12:44044306-44044328 GTTATCTGCAGAAGAATGGCAGG - Intronic
1095844403 12:46729996-46730018 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1095856244 12:46863703-46863725 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1096173054 12:49489447-49489469 TTTATCTGGAAAAGATGACAGGG - Exonic
1096288709 12:50322932-50322954 GTTATCTACAGAAGATGGCAGGG - Intergenic
1096457473 12:51799465-51799487 GTTATCTGCAGAAGATGGCAGGG + Intronic
1097076997 12:56402413-56402435 GTTATCGCCAGAAGATGGCAGGG - Intergenic
1097437844 12:59572282-59572304 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1097556459 12:61145032-61145054 GTTAACTGCAAAAGAGGGAATGG + Intergenic
1097821386 12:64132192-64132214 GTTATCTGCAGAAGAAGGCAGGG + Intronic
1098231590 12:68376599-68376621 GTTTTCTAAAAAAGATGGCAAGG + Intergenic
1098673037 12:73254216-73254238 GTTAACTGCAGAAGATGGCAGGG - Intergenic
1098716087 12:73829787-73829809 GTTATCTGCAAAAGATGGCAAGG - Intergenic
1098731048 12:74037320-74037342 GTTATCTGCAGAAGATAGCAGGG - Intergenic
1098733287 12:74065603-74065625 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1098749844 12:74279563-74279585 GTTATCTGCAGAAGATGACAGGG - Intergenic
1098831908 12:75374053-75374075 GTTATCTGCGGAAGATAGCAGGG + Intronic
1099183383 12:79492616-79492638 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1099365920 12:81765356-81765378 GTTATCTGCAGAATATGGCAGGG - Intergenic
1099379385 12:81936568-81936590 GTTATCTGCAGAAGATGGCATGG + Intergenic
1099526359 12:83723083-83723105 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1099578070 12:84405366-84405388 GGCATATACAGAAGATGGCAGGG - Intergenic
1099689777 12:85938009-85938031 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1099821352 12:87715108-87715130 GTCATCTGCAAAGAATGGCAGGG + Intergenic
1099995070 12:89769558-89769580 GTTATCTGAAGAGGATGGCAGGG + Intergenic
1100163720 12:91892589-91892611 GCCATCTGCAGTAGATGGCTTGG - Intergenic
1100241156 12:92711636-92711658 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1100634369 12:96421103-96421125 GTTACCAGTAGAAGATGGCCAGG + Intergenic
1101222653 12:102657369-102657391 GTTATCTGCAGAGGATGGAAAGG - Intergenic
1101264128 12:103066094-103066116 GTTATCTGCAGAAGATGACAGGG - Intergenic
1101534671 12:105606132-105606154 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1101539526 12:105652455-105652477 ATTATCTGCTGCAGATGGCATGG - Intergenic
1101543068 12:105682608-105682630 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1102617654 12:114168725-114168747 GTGAGCTGTAGAAGAGGGCAAGG - Intergenic
1102620467 12:114190670-114190692 GTTATAGGCAGAAAATGGAAAGG - Intergenic
1103035608 12:117654035-117654057 GTTATCTGCAGAAGATGGCAGGG - Intronic
1103877209 12:124137359-124137381 GTTAGATGCTGGAGATGGCAAGG + Intronic
1105033331 12:132900521-132900543 ATTATCTGCAGACAATGTCAGGG + Intronic
1105728463 13:23187883-23187905 TTTCTCTGCTGCAGATGGCATGG + Intronic
1105740105 13:23315148-23315170 GTTATCTTCAGAAGATGGCAGGG - Intronic
1106054797 13:26228204-26228226 GTTCTCTGCAGCAGATGGCATGG + Intergenic
1107505166 13:41026590-41026612 ATTATCTGCAGTTGATGGCAAGG - Intronic
1107942141 13:45384136-45384158 GTTATTTGCAAAAGATAACATGG + Intergenic
1107983579 13:45756000-45756022 GTTATCTGCAGAAGATGACAGGG + Intergenic
1108302440 13:49092013-49092035 GTTATCTGCGGAAGATGGCAGGG + Intronic
1108904274 13:55449943-55449965 GTTATTTGCAGAAGATGGCAGGG - Intergenic
1108914306 13:55588899-55588921 CTTATCTGCAGGAGATGGCAGGG + Intergenic
1109293220 13:60500090-60500112 GTTATCCACAGAAGATGGCAGGG - Intronic
1109564503 13:64094627-64094649 ATTTACTGCAGGAGATGGCAAGG - Intergenic
1109712684 13:66180850-66180872 GTTTTCTACAGAAGATGGCAGGG + Intergenic
1109951027 13:69502233-69502255 GTTATCTGCAGAAGATAGCAGGG + Intergenic
1110323788 13:74190379-74190401 GTAAGCTGTAGAAGAAGGCAAGG - Intergenic
1110834139 13:80064657-80064679 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1110958386 13:81586790-81586812 GTTATGTGCAGAAAAAGTCAGGG - Intergenic
1111317498 13:86581775-86581797 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1111432256 13:88159662-88159684 GTTAACTCTAGACGATGGCAAGG + Intergenic
1111842068 13:93462009-93462031 AGTATCTACATAAGATGGCATGG - Intronic
1112231130 13:97590192-97590214 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1112249932 13:97770306-97770328 ATTATCTGCAGAAGATGGCAGGG + Intergenic
1113111598 13:106829597-106829619 GTTATCTGCTGATGATGGCAAGG + Intergenic
1113319709 13:109221691-109221713 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1114205867 14:20570741-20570763 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1114396697 14:22370140-22370162 GTTATCTGCAGAGTATGGCATGG + Intergenic
1114905379 14:27120450-27120472 GCTATCTGAAGAAGATGGCAGGG + Intergenic
1115059713 14:29173866-29173888 GTTATCTGCAGAAGATGACAGGG - Intergenic
1115125771 14:29991710-29991732 GTTCTTTGTAGAAGTTGGCAAGG + Intronic
1115143395 14:30199359-30199381 GTTATCTCCAGAAGATAACAGGG - Intergenic
1116058904 14:39896910-39896932 GTTATCTGTAGAATATGGCAGGG - Intergenic
1116068090 14:40009143-40009165 GTTATCTGAAGAAGATGGGAGGG - Intergenic
1116308049 14:43283475-43283497 GTTATCTGCAGAAGATGGTAGGG + Intergenic
1116415068 14:44669284-44669306 GTTATTTGCAGAAGATGGCAGGG - Intergenic
1116523353 14:45875326-45875348 GTTATATGTAGAAAAAGGCAAGG + Intergenic
1116551694 14:46247818-46247840 GATATCTGCAGCAGATGGGTAGG + Intergenic
1116660933 14:47709457-47709479 GTTATCTGCCAAAGAGGGCATGG - Intergenic
1117001596 14:51376284-51376306 GTTATCTGCAGAAGATCACAGGG - Intergenic
1117216839 14:53560147-53560169 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1117634129 14:57724345-57724367 GTTATCTGCAGAAGATGGCAGGG - Intronic
1118017736 14:61676809-61676831 GTTCTTTGCAGCAGAAGGCATGG + Intergenic
1118122437 14:62860198-62860220 GTTATCTGCAGAAGACGGCAGGG + Intronic
1118501831 14:66369363-66369385 GTTATCTGTGGATGATTGCAGGG - Intergenic
1118880778 14:69824046-69824068 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1118988927 14:70780591-70780613 TTAATTTGCACAAGATGGCAAGG - Intronic
1119107567 14:71938867-71938889 GTTACCTGCAGAAGATGACAGGG + Intronic
1119396882 14:74332875-74332897 GTTTCCTGAAGAAGGTGGCATGG - Intronic
1120082028 14:80227558-80227580 GTTATCTGCAGAAGATGGCAGGG + Intronic
1120169403 14:81233958-81233980 GTTATCTGCAGAAAATGGCAGGG - Intergenic
1120250744 14:82059677-82059699 ATTATCTGCAAATGATGGCAGGG + Intergenic
1120555998 14:85930473-85930495 GTTATCTGCATAAGATGGCAGGG + Intergenic
1123817818 15:23997530-23997552 GTTATCTGTGGATGATGGCAGGG + Intergenic
1123908504 15:24943682-24943704 GTTAACTACAGAGGATAGCAGGG + Intronic
1126283606 15:46986249-46986271 GTTGTCTGCAGAAGATGGCAGGG - Intergenic
1127356910 15:58209161-58209183 GTTATCTGCAGAAGATGGCAGGG - Intronic
1127661746 15:61105974-61105996 TTTATCTTCATAAGCTGGCAAGG + Intronic
1129887427 15:79048307-79048329 GTTATGTGCAGGAGGTGGCCTGG + Intronic
1129973690 15:79803230-79803252 GTTTGCTGCATAAGATAGCAAGG - Intergenic
1130209017 15:81906148-81906170 GTTATTTGCTGAATTTGGCAAGG + Intergenic
1131398713 15:92107681-92107703 GCTGTCTGCAGAGCATGGCAGGG - Intronic
1131724006 15:95202767-95202789 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1132305743 15:100810892-100810914 GTTATTTGCAGAGGATAGCAAGG + Intergenic
1135688073 16:24514335-24514357 GTTCTCTGTTGCAGATGGCATGG - Intergenic
1136250937 16:29004563-29004585 GTTATCTGCAGAAGATGGCGGGG - Intergenic
1138868381 16:60850757-60850779 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1139049136 16:63101822-63101844 GTTTTCTGCTGCAAATGGCATGG + Intergenic
1140816908 16:78629580-78629602 GTAAGCTGCAGAGGTTGGCAGGG - Intronic
1141559547 16:84858066-84858088 GTTATCTGCAGAAGATGGCAGGG + Intronic
1142505848 17:362759-362781 GTTATCCGAAGAAAATGGGAGGG + Intronic
1143050119 17:4118378-4118400 GTTATCTGCAAAAGATAGTAGGG + Intronic
1146237980 17:31185920-31185942 GTTATCTGCAGAAGATGGCAGGG - Intronic
1146836351 17:36113972-36113994 GTTATCTGAACAAGATGGCAGGG - Intergenic
1146850930 17:36221012-36221034 GTTATCTGAACTAGATGGCAGGG - Intronic
1146974394 17:37098475-37098497 GTTATCTGCCAAACTTGGCAAGG + Intronic
1147506184 17:41019732-41019754 GTTATTTTCAGAGGAGGGCATGG + Intergenic
1147984071 17:44294432-44294454 GTCCTCTGCTGTAGATGGCATGG + Intergenic
1151037815 17:70821616-70821638 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1153089703 18:1330130-1330152 GTTAACTGCAGAAGATGGCAGGG - Intergenic
1153131279 18:1857741-1857763 GTTATCTGTAGAAGATGGCAGGG + Intergenic
1153193630 18:2569924-2569946 GATAACAGCAGAAGGTGGCAGGG - Intronic
1153217697 18:2835634-2835656 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1154068460 18:11131067-11131089 GTTATCTGCAGAAGGTGGCAGGG - Intronic
1154252675 18:12757307-12757329 GTTACCTGCAGAAGATGGCAGGG + Intergenic
1154366973 18:13720143-13720165 GTTACCTGCAAAGGATGGAAAGG + Intronic
1154506168 18:15042858-15042880 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1155300457 18:24424607-24424629 GTAATCTGTAGAAGATGGCCTGG + Intergenic
1155940703 18:31799566-31799588 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1156303858 18:35858662-35858684 GTTATCTGCAGAAGATAGCATGG - Intergenic
1156606367 18:38671733-38671755 GTTATCTTCAGAAGATGGCAGGG - Intergenic
1156990308 18:43400807-43400829 GTTATCTGCAGAAGACGGCAGGG + Intergenic
1157341197 18:46779995-46780017 GTTATCTGGAGAAGATGGCAGGG - Intergenic
1157475751 18:48022390-48022412 CTCATCTGCAGAATACGGCATGG + Intergenic
1157520233 18:48340509-48340531 GCTATGTGCAGAAGATGCCATGG + Intronic
1157870935 18:51229613-51229635 GTTACCTGCAGAAGATGGTAAGG + Intergenic
1157927380 18:51781108-51781130 GCAATCTGGAGAAGCTGGCACGG - Intergenic
1158769846 18:60502015-60502037 GTGATATGCAGAAGATGTCCTGG - Intergenic
1158917266 18:62146409-62146431 TCTTTCTGGAGAAGATGGCAAGG + Intronic
1159156451 18:64589394-64589416 GTTATCTGGCGAAATTGGCAGGG + Intergenic
1159287786 18:66375450-66375472 GTTATCTGCAGAAGATAGCAGGG - Intergenic
1159559109 18:69975383-69975405 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1159849059 18:73504090-73504112 ATTATCTTCAGAAAATTGCAAGG + Intergenic
1159997131 18:74976674-74976696 GCTATTGGCAGAACATGGCAAGG - Intronic
1162266616 19:9580826-9580848 TTAATCTGCACAAGAGGGCATGG - Intronic
1162277835 19:9671791-9671813 TTAATCTGCACAAGAGGGCATGG - Intronic
1162285001 19:9731652-9731674 GTTTCCTGCAGAAGATGGCATGG - Intergenic
1162803698 19:13125301-13125323 GGTATCTGCACAGGGTGGCAAGG + Intronic
1164097090 19:22021375-22021397 GTTATCTGCAGAAAATGGCAGGG + Intergenic
1164117262 19:22234606-22234628 GTTATCTGCAGAAAATGGCAGGG + Intergenic
1166377643 19:42336617-42336639 GTTACCTGCATAAGCTAGCAAGG - Intronic
1167394111 19:49216344-49216366 GTTGTGTGCAGAAGATGGCATGG - Intergenic
1168539340 19:57197402-57197424 GTTATCTGCAGAAGATGGCAGGG + Intronic
925182702 2:1827299-1827321 GTGATCTGCAGGAGGTGGAAGGG - Intronic
925358779 2:3262718-3262740 GTTCTGTGCTGCAGATGGCATGG - Intronic
925499411 2:4486953-4486975 ATAATCTGCAGAAAATGGCAGGG + Intergenic
925599234 2:5590978-5591000 GTTTTCTGCAGTGGCTGGCACGG - Intergenic
926275033 2:11397078-11397100 ATTCTCTGCTGCAGATGGCATGG + Intergenic
926810400 2:16750707-16750729 AGTATCTGCAGAAGATGGCAGGG + Intergenic
926825570 2:16902262-16902284 GTTATCTGCAGAAGATGGCAGGG + Intergenic
926826758 2:16913637-16913659 AGTATCTGCAGAAGGTGGCATGG - Intergenic
926887617 2:17612546-17612568 GTCATCTACAGAAGAGGCCAGGG + Intronic
927008713 2:18879692-18879714 CTTATCTGCAGAAGATGGCAGGG - Intergenic
928117069 2:28553210-28553232 GTTCTTTGCAGAACATGGCCTGG - Intronic
930056711 2:47257905-47257927 GGCATCTGAAGAAGATGGGAAGG + Intergenic
930152428 2:48072177-48072199 GTTATGTGCATGAGATGCCAAGG + Intergenic
930295408 2:49547541-49547563 GTTACCTGCAGAAGATGGCAGGG + Intergenic
930418598 2:51120963-51120985 GTTATAAGTAGAAGATGGTAGGG - Intergenic
930910147 2:56620867-56620889 GTTATCTGCAGAAGATGCCAGGG - Intergenic
932459245 2:71871853-71871875 GTTCCCTGGAGAAGATGGGATGG + Intergenic
932609421 2:73187765-73187787 GGAAGCTGCATAAGATGGCAAGG - Intergenic
933265688 2:80178413-80178435 GTTATCTGCAGAAGATGACAGGG + Intronic
934305738 2:91820564-91820586 GTTAACTGGAGAAGATGACCGGG - Intergenic
934327518 2:92032178-92032200 GTTAACTGGAGAAGATGACCGGG + Intergenic
934465907 2:94262757-94262779 GTTAACTGGAGAAGATGACCGGG + Intergenic
934720886 2:96575747-96575769 GTTACTTGGAGAAGAGGGCATGG - Intergenic
935183931 2:100714869-100714891 GTTATTTTCAGAAGATGGTAGGG - Intergenic
935425114 2:102911357-102911379 GTTATTTGCAGAAGATGGCAGGG + Intergenic
935564313 2:104590283-104590305 GTTATCTGCAGAAGATGGCAGGG + Intergenic
936641220 2:114314660-114314682 GTTATCTGGACAAGATGGGAGGG - Intergenic
937582067 2:123499197-123499219 GTTCTCTGCAGAAGAAGACAGGG + Intergenic
937800323 2:126074698-126074720 CTTATCTGAAGAAGATGGCAGGG - Intergenic
937852574 2:126648768-126648790 GCTATCTGCAGGAGATGACAGGG + Intergenic
938709574 2:133964606-133964628 GTTATCTGCAGAGGATAGCATGG - Intergenic
939069057 2:137517826-137517848 GTTATCTGCAGAAGATGGCAGGG - Intronic
939213868 2:139212210-139212232 GTTATCTGCAGAAGATGGCAGGG - Intergenic
939633369 2:144551813-144551835 GTTATCTGCAGATGATGGCAGGG + Intergenic
939755228 2:146101774-146101796 GTTATCTGCAGAGGAAGGCAGGG - Intergenic
939788689 2:146546143-146546165 GTTATCTGCAGAAGATGCCAGGG + Intergenic
939806236 2:146778444-146778466 GTTATCTGCAGAAGATGGCAGGG - Intergenic
940171316 2:150832742-150832764 GTTATCTGCAGAAGTTGATAGGG + Intergenic
940472092 2:154113157-154113179 GTTATCTGCAGAAGATGGCATGG + Intronic
941330672 2:164174595-164174617 CTTATCTGACAAAGATGGCAGGG + Intergenic
941668013 2:168261100-168261122 GTTATCTGCAGAAGATGGCAGGG - Intergenic
942321942 2:174743516-174743538 CTTATCTGCAGATGATGGCAGGG - Intergenic
943006892 2:182395811-182395833 GTTATCTGGAGAAGATGGCAGGG - Intronic
943239223 2:185362602-185362624 GTTATCTGCAGAAGATGGCAGGG + Intergenic
943384067 2:187181120-187181142 GCTATCTGTGGAAGATGGCAGGG + Intergenic
943388125 2:187227106-187227128 GTTATCTGCAGAAGATGGTAGGG - Intergenic
943517602 2:188907272-188907294 GTTATCTGCAGAAGATGGCAGGG + Intergenic
943799890 2:192044748-192044770 GTTATCCACAGAAGATATCAGGG - Intronic
944980762 2:205117343-205117365 CTTCCCTGCAGTAGATGGCATGG + Intronic
945443804 2:209912250-209912272 GTTATCAGCAGAAAAAGGAAAGG - Intronic
945544866 2:211138127-211138149 GTTATCTGCAGAAGATGGCAGGG - Intergenic
945642174 2:212443807-212443829 CTTATCTGCAGAACATGGCAGGG - Intronic
945717839 2:213380699-213380721 GTTATCTGCAGAAGATGGCAGGG + Intronic
945725849 2:213471525-213471547 GTTATCTGCAGAAGATGGCAGGG + Intronic
946181926 2:217954063-217954085 GCCATCTGCAGAAGCTGGCTTGG + Intronic
946278912 2:218651956-218651978 GTTCTCTGCTGAAGATCGCAAGG - Intronic
946527872 2:220539997-220540019 GTTATCTGCAGAAGATGGCAGGG + Intergenic
946703778 2:222437822-222437844 GTTATCTGCAGAAAATGGTAGGG + Intronic
946790917 2:223299730-223299752 GTTATCTGCAAATGATGGCAGGG - Intergenic
947136745 2:226983504-226983526 GTTATCTGCAGTAGTTGTCCAGG + Intronic
947184323 2:227441614-227441636 GTCATCTGCAGGTGCTGGCAGGG + Intergenic
947404441 2:229760242-229760264 ATCATCTGCAGGAGATGCCATGG - Intergenic
947440719 2:230118696-230118718 GTTATCTGCAGAAGATGGCAGGG + Intergenic
947440842 2:230120227-230120249 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1169510248 20:6256003-6256025 GTGCTCTGAAGAAGGTGGCATGG + Intergenic
1170005985 20:11669586-11669608 GTGTTCTGCAGAAGATGTTAGGG - Intergenic
1170092313 20:12604141-12604163 GGTATCTGCAGAGGATGACAGGG + Intergenic
1171542615 20:25976152-25976174 GATGTCAGCAGAAAATGGCAGGG - Intergenic
1171798445 20:29584371-29584393 GATGTCAGCAGAAAATGGCAGGG + Intergenic
1171845650 20:30272802-30272824 GATGTCAGCAGAAAATGGCAGGG - Intergenic
1172385461 20:34531058-34531080 GGTAGCAGCAGAGGATGGCAGGG - Intronic
1173174185 20:40751917-40751939 GTTATCTGAATAAGCTTGCATGG + Intergenic
1173974322 20:47175620-47175642 GTTATCTGGGGAAGGTGGGAAGG + Intronic
1175039010 20:56027906-56027928 ATTATCTGCTACAGATGGCATGG + Intergenic
1175378920 20:58549175-58549197 GTGATCTGCAAATGATGGGAGGG - Intergenic
1176422630 21:6528194-6528216 GCTTTCTGCAGACCATGGCAGGG - Intergenic
1176596903 21:8705952-8705974 GTTAACTGGAGAAGATGACCAGG + Intergenic
1176791685 21:13326166-13326188 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1176870520 21:14080128-14080150 GTTATCTGCAGATAATGGCAGGG - Intergenic
1176998156 21:15580154-15580176 GTTATCTGCAGAAGACGGCAGGG - Intergenic
1177139422 21:17342299-17342321 GTTATCTGCAGGAGACGGCAGGG + Intergenic
1177430304 21:20983709-20983731 GTTCTCTGAAAAAGTTGGCATGG - Intergenic
1177505565 21:22014212-22014234 GTTATCTGCAGAAGATGGAAGGG + Intergenic
1177913171 21:27056180-27056202 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1177933701 21:27316963-27316985 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1177991075 21:28037168-28037190 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1178012656 21:28305145-28305167 GTTATCAGCAGAAGATGGCAGGG - Intergenic
1178060759 21:28851168-28851190 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1178825809 21:36015814-36015836 ATTACATGCAGAAGATGGCCTGG - Intergenic
1178961347 21:37068985-37069007 GTTTTCTGCAGGGGAGGGCAGGG + Intronic
1179182826 21:39060294-39060316 GTTGTCTGCTGAAGATCACAAGG + Intergenic
1179415154 21:41192551-41192573 GTTATCTGAAGAAGATGGCAGGG + Intronic
1179458198 21:41514173-41514195 TTTATCTGTGGAGGATGGCAAGG + Intronic
1179698123 21:43136510-43136532 GCTTTCTGCAGACCATGGCAGGG - Intergenic
1179923140 21:44518291-44518313 CTTAGCTGGAGAGGATGGCATGG + Exonic
1180587042 22:16901930-16901952 GTTAACTGGAGAAGATGACCGGG + Intergenic
1180591151 22:16938397-16938419 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1181367440 22:22388974-22388996 GCTACCTGCAGAAGATGGCAGGG + Intergenic
1181420649 22:22795801-22795823 GTTATCTGTAGAGGATGGCAGGG - Intronic
1182505925 22:30782307-30782329 GTTGTCTGCAGGAGGTGGAAGGG - Intronic
1184603565 22:45558405-45558427 GTTATCTGCAGAAGATGGCAGGG + Intronic
1185395608 22:50585889-50585911 GTTCTCTGCTGCAGAAGGCATGG - Intronic
949125668 3:443176-443198 GTTATCTGCAGAAGATGGCAGGG + Intergenic
949245862 3:1924892-1924914 GTTATCTGCAGAAGGTGGCGGGG - Intergenic
949280030 3:2334996-2335018 GTTAGATGCAGCAGCTGGCAAGG - Intronic
949417596 3:3830913-3830935 GTTATCTGCAGAAGATGGCAGGG + Intronic
949445607 3:4131023-4131045 GTTATCTGCAGAAGATGGCAGGG - Intronic
949638776 3:6012486-6012508 GTTATCTGCAAAAGATGGCAGGG - Intergenic
951003615 3:17592821-17592843 GTTATCTACAGAAGATGGCAGGG - Intronic
951122566 3:18945536-18945558 GTTATCTGCAGAAGATGGCAGGG - Intergenic
951291522 3:20876776-20876798 GTTATCTGCACAAGACAGCAGGG + Intergenic
951571106 3:24064221-24064243 GTTAACTGCAGAGTGTGGCAGGG + Intergenic
951970767 3:28441896-28441918 GTTATCTGCAGAAGATGGCAGGG + Intronic
954054114 3:48007646-48007668 GTTATCTGTAGAAGATGGCAGGG - Intronic
955035580 3:55264061-55264083 GTTATCTGCAGAGGATGGCAGGG - Intergenic
956306871 3:67835591-67835613 GTTATCTGCAGAAGATGGCAGGG - Intergenic
956360448 3:68441407-68441429 GTAATCTGCAGAAGATGGCAGGG - Intronic
956509657 3:69980341-69980363 GTTATCTGCAGAAGATGGCAGGG - Intergenic
956703898 3:71982918-71982940 GTTATCTGCAGAAGATGACAGGG + Intergenic
956952441 3:74297951-74297973 GTTCTCTGCAGAAGAAGGTATGG - Exonic
957247585 3:77733928-77733950 GTTATCTGCAGAAGATGGCAGGG + Intergenic
957298503 3:78361674-78361696 GTTATCAGTAGAAGATGGCAAGG + Intergenic
957754593 3:84469395-84469417 GTTATCTGCAGAAGATGGCAGGG - Intergenic
957874586 3:86129293-86129315 GTAATCTGAAGAAGACAGCAGGG - Intergenic
957897666 3:86444893-86444915 GATTTTTGCAGAAGAGGGCAAGG - Intergenic
958487682 3:94732505-94732527 GTTATCTGCAGAAGATGGCAGGG + Intergenic
958934300 3:100240597-100240619 GCTATCTGCAGAAGATAACATGG - Intergenic
959203656 3:103279276-103279298 GTTATCTGCAGAAGATGGCAGGG + Intergenic
959377349 3:105602865-105602887 GTTATCTGCGGAAGATGGTAGGG + Intergenic
959439505 3:106359151-106359173 GTTATCTGCAGAAGACGGCAGGG - Intergenic
959746018 3:109777304-109777326 GTTATCTGCAGAAGATGGCAGGG + Intergenic
959997855 3:112698291-112698313 GTTATCTGCAGAAGATGGAAGGG - Intergenic
960149375 3:114234765-114234787 GTTTTCTGCAGGAAATGGGATGG - Exonic
960494750 3:118360811-118360833 GTTATCTGAAGATGATGGCAGGG + Intergenic
961262844 3:125616392-125616414 GTTATCTGCAGAAGATGGTAGGG - Intergenic
962830127 3:139132196-139132218 GTTTTCTACAGTAGAGGGCAAGG - Intronic
963045358 3:141098698-141098720 ATTATCTGCAGAAGATTTGATGG - Intronic
963355666 3:144206891-144206913 CTTATCTTCTGAAGATGGCAAGG + Intergenic
963548683 3:146694367-146694389 GTTACCTATAGATGATGGCAAGG + Intergenic
963630306 3:147723189-147723211 GTTATCTGCAGAAGATTACAGGG - Intergenic
963661388 3:148132114-148132136 GTTATCTGCAGAAGGTGGCAGGG - Intergenic
964147643 3:153484567-153484589 GTGATCTGCAGAAGCTGGTCAGG + Exonic
964297668 3:155251890-155251912 GTTATCTGCAGATGATGGGAGGG - Intergenic
964679250 3:159318945-159318967 GTTATCTGCAGAAGATGGCAGGG + Intronic
965251335 3:166348298-166348320 GTTATCTGCAGAAGATTCCAGGG + Intergenic
965291745 3:166889611-166889633 GTTATATGCAGAAGATGGCAGGG + Intergenic
965708649 3:171534810-171534832 GTTATCTGCAGAGGATGGCAGGG + Intergenic
965893162 3:173540125-173540147 GTCATCTGCAGAGGATGGCAGGG + Intronic
966044334 3:175530952-175530974 GTTATCTGCAGAAGATGGCAGGG + Intronic
966445689 3:179998528-179998550 GTTATCTGCAGAAGATGGCAGGG - Intronic
966480563 3:180403935-180403957 GTTATCTGCAGAGGGTGGTAGGG - Intergenic
966661309 3:182417978-182418000 GTTATCTGCAAATGATGGCAGGG - Intergenic
967119915 3:186373708-186373730 GTTACCTCCAGAGGATGGCTTGG - Intergenic
968800179 4:2738090-2738112 GTTAGCTGCAGAAGATGGCAGGG - Intergenic
968906941 4:3457936-3457958 GTTATCTGCGGAAGATGGCAGGG - Intergenic
969632727 4:8347774-8347796 GTTCTCTGTAGCACATGGCAGGG + Intergenic
970538715 4:17056075-17056097 TTTATATGCAGAAGACAGCATGG - Intergenic
970941613 4:21640943-21640965 GTTATCTGCAGAGAGTGGCAGGG - Intronic
971101015 4:23466453-23466475 GTTATCTGCAGAAGATAGCAGGG + Intergenic
971817225 4:31505044-31505066 GTTATCTGCAGAAGATGGCAGGG - Intergenic
971979299 4:33732904-33732926 GTTACCTGCAGAAGATGGCAGGG + Intergenic
972095489 4:35342660-35342682 GTTACTTGCAGAAGACGGCAGGG - Intergenic
972201302 4:36717184-36717206 GTTATCTGTAGAAGATGGCAGGG + Intergenic
972762205 4:42117784-42117806 GGTTTTTGCAGAAGATGACAGGG + Intronic
972805912 4:42529296-42529318 GTTACCTGCAGATTATGGCAGGG - Intronic
972882966 4:43448185-43448207 GTTATCTGCAGAAGATGGCAGGG + Intergenic
973102921 4:46294719-46294741 GTTATCTGCAGAAGATGGCAGGG - Intronic
973118435 4:46489012-46489034 GTTATCTGCAGAAGATGGCAGGG - Intergenic
973120984 4:46520929-46520951 GTTATTTGCAGAAGATGGCAGGG + Intergenic
973130194 4:46639726-46639748 GTTATATTCAGAACATGGCAGGG + Intergenic
973143677 4:46798575-46798597 GCTTTCTGCAGATCATGGCAGGG - Intronic
974289564 4:59912711-59912733 GTTAACTGTAGAAGATGGCAGGG - Intergenic
974479041 4:62420867-62420889 ACTATCTGCAGAAGATGGCAAGG + Intergenic
974644620 4:64674795-64674817 ATTATCTGCAGGAAATGGCAGGG + Intergenic
974746918 4:66088936-66088958 GTTATCTTCAGAAGATGGCAGGG + Intergenic
975033163 4:69649307-69649329 TTTCTCTGCAGAAGATGTTATGG + Intronic
975051320 4:69868170-69868192 GTTATCTGTAGATGATGGCAAGG - Intergenic
975361851 4:73479605-73479627 GTGATGTGTAGAAAATGGCAGGG - Intergenic
976034209 4:80795852-80795874 GTTATTTGCAGAAGATGGCAGGG + Intronic
977031618 4:91891376-91891398 GTTATCTACAGAAGATGGCAGGG - Intergenic
977204713 4:94155653-94155675 GTTATCTGCAGAAGATGACAGGG - Intergenic
977337381 4:95716129-95716151 GTTATCTGCGGAGGGTGTCAGGG + Intergenic
977430762 4:96928181-96928203 GGTATCTGCAGAAGATGGCAGGG - Intergenic
977465997 4:97383343-97383365 GTTATCTGCAGAAGATGGCAGGG - Intronic
977626280 4:99192685-99192707 GTTATCTGCAGAAGATGGCAGGG + Intergenic
977701735 4:100029918-100029940 GTTATCTACAGAAGTTGGCAGGG + Intergenic
977847097 4:101779252-101779274 GCAATCTGCAGATGATGTCAGGG + Intronic
977930416 4:102743850-102743872 GTTATCTGCAGAAGATGGCAGGG + Intronic
978341594 4:107725580-107725602 GTTATCTGGAGAATATGTCAGGG + Intergenic
978539963 4:109805812-109805834 ATTCTCTGCTGCAGATGGCATGG + Intergenic
978665289 4:111174768-111174790 GGTATCTGAAGAGGGTGGCAAGG - Intergenic
978772156 4:112467811-112467833 GTTATCTGCAGAAGATGGCAGGG + Intergenic
978899081 4:113926849-113926871 GTTATCTGCAGAAGACGGCAGGG + Intronic
978966847 4:114750913-114750935 ATTATCTGCAGAAGATGGCAGGG - Intergenic
979048206 4:115896511-115896533 GTTATCTGCAGAAGATGGCATGG - Intergenic
979363529 4:119792951-119792973 GTTTTGTGCAGAAGATGACCAGG + Intergenic
979456992 4:120937984-120938006 GTTATCTGCAGCTGAAGGGAGGG + Intergenic
979562888 4:122120166-122120188 ATTTTCTGCTGCAGATGGCATGG - Intergenic
979595736 4:122532216-122532238 GTTCTCTGAAGATGATAGCAGGG + Intergenic
979735813 4:124082220-124082242 GTAATCTGTAGAAGATCTCATGG + Intergenic
979767016 4:124474564-124474586 GTTATCTGTAGAAGATGGCAGGG - Intergenic
979768456 4:124491906-124491928 GTTATCTGCAGAATTTCTCATGG - Intergenic
980385791 4:132087062-132087084 GTTATCTGCAGAAGATGGCAGGG + Intergenic
980387951 4:132111212-132111234 GTTATCTGCAGAATATGGCAGGG + Intergenic
980405895 4:132353822-132353844 GTTATCTGCAGAAGATGGCAGGG + Intergenic
980429011 4:132666060-132666082 CTTATCTCCAGAAGCTGGGAAGG + Intergenic
980497529 4:133605393-133605415 GTTATCTACAGAAGATTACAGGG + Intergenic
980602156 4:135039489-135039511 GTGTTCTGCAGAAGATGGCAAGG - Intergenic
980629519 4:135414255-135414277 GTTATATGCAGAAGATGGCAGGG - Intergenic
980740122 4:136939359-136939381 CTGATCAGCAGAAGCTGGCAGGG + Intergenic
980957728 4:139445886-139445908 GTTATCTGCAGAAGATGTCAGGG - Intergenic
981330859 4:143507898-143507920 ATTATCTGCAGGAGATAGTATGG + Intergenic
981835000 4:149043914-149043936 GTTATCTGCAGAATATGGCCAGG - Intergenic
981873531 4:149515162-149515184 GTTATCTCCAAAAGATGGCAGGG - Intergenic
982354483 4:154451267-154451289 GTTGTCTGCAGAGAATGGCAGGG - Intronic
983027386 4:162755264-162755286 GTTATCTGCAGAAGATGGCAGGG - Intergenic
983147514 4:164235559-164235581 GTTATATGCAGAAACTGGCATGG + Intronic
983185060 4:164691544-164691566 GTTATCTGCAGAAGATGGCAGGG - Intergenic
983339032 4:166434438-166434460 GTTATCTGCAGAGAATGGAAGGG - Intergenic
984060288 4:174982055-174982077 GTTATCTGCAGAAGATGGCAGGG + Intergenic
984410462 4:179391177-179391199 GTTATCCAGAGAAGAAGGCAGGG + Intergenic
986087106 5:4462687-4462709 TTTATCTGCAGAAGATAGCAGGG - Intergenic
986742915 5:10719475-10719497 GTTATCTGCAGAAGATGGCAGGG - Intronic
986938335 5:12918781-12918803 GTTACCTGAAGAAGATGGCAGGG + Intergenic
986959835 5:13199188-13199210 GTTAACTGCAGAAGATGGCAGGG - Intergenic
987153170 5:15061635-15061657 GTTATCTGCAGAAGATGGCAGGG - Intergenic
987176676 5:15318668-15318690 GTTATGTGCAGAAGAGCGCATGG - Intergenic
987504384 5:18749823-18749845 GTTAACTACAGAAGATGACAGGG - Intergenic
987578346 5:19758342-19758364 ATTATATGCAGAAGATGGCAGGG + Intronic
987657142 5:20821682-20821704 GTTATTTGCAAAAGATGGCAGGG + Intergenic
987774797 5:22350636-22350658 TTTATCTGCAAAATATTGCATGG + Intronic
988056572 5:26105298-26105320 GTTATCTGCAGAAGATGGCAGGG + Intergenic
988160827 5:27516901-27516923 TTTATCTAAAGAAGATAGCATGG + Intergenic
988169206 5:27632868-27632890 GCGATCTGCAGAAGATGGCAGGG + Intergenic
988188770 5:27901206-27901228 GTTATCTGCAGAAGATGGCAGGG - Intergenic
988228765 5:28448096-28448118 TTTATCTGCAGAAGATGGTAGGG - Intergenic
988562126 5:32290817-32290839 GTTATCTGCAGAAGATGGCAGGG - Intronic
988766409 5:34382266-34382288 GTTATCTGCAAAAGATGGCAGGG - Intergenic
989045211 5:37267621-37267643 GTTATCTGAAGAAGATGGTAGGG + Intergenic
989097827 5:37797290-37797312 GTTATCTGCAGAAGATGGCAGGG - Intergenic
989307507 5:39974651-39974673 GCTATCTGAAGAAGATGGCAGGG + Intergenic
989457648 5:41661798-41661820 GTTATCTGCAGAAGATGGCGGGG + Intergenic
989486388 5:41996389-41996411 GTTATCTGCAAAAGATGGCAGGG + Intergenic
989550332 5:42727424-42727446 GTTATCTGCTGAAGAGAACATGG + Intergenic
990723712 5:58729111-58729133 GTGATCTGCAGAAAGTGCCAGGG - Intronic
991013810 5:61910930-61910952 GTTATCTGCAGAAGATAGCAGGG + Intergenic
991033541 5:62105892-62105914 GTTATCTGCAGAAAATGGCAGGG - Intergenic
991946142 5:71900110-71900132 GTTATCTGCAGAAGATGGCAGGG - Intergenic
992109884 5:73482907-73482929 GTTATCTGCAGAAGATGACAGGG + Intergenic
992242935 5:74789721-74789743 GTTATCTGAAGAAGATGGCAGGG - Intronic
992242951 5:74789837-74789859 GTTATCTGCAGAAGATGGCAGGG - Intronic
993203390 5:84847510-84847532 GTTATCTGCAGAAGACAGCAGGG - Intergenic
993319824 5:86458548-86458570 GTTATCTGCAGAAGATAGTAGGG - Intergenic
993367472 5:87050986-87051008 GTTATCTGCAGAAGATGGCAGGG + Intergenic
993516102 5:88836735-88836757 GTTATCTGCCGAGGATGACTTGG - Intronic
993791787 5:92218881-92218903 TTTATCTGCAGAAGATGGCAGGG - Intergenic
994275298 5:97829658-97829680 GTTATCTACTGTGGATGGCATGG + Intergenic
994291378 5:98032001-98032023 GTTATCCACAGAAGATGGCAGGG + Intergenic
994855439 5:105113614-105113636 GTTATCTGCAGAAGATGGCAGGG + Intergenic
994984424 5:106915763-106915785 GTTATCTGCAGAAGATGGCAGGG + Intergenic
995269561 5:110205496-110205518 GCTATGTGCAGAAGATGGCAGGG + Intergenic
995427737 5:112043756-112043778 GTTATTTGCAGAAGATGGCAGGG + Intergenic
995776289 5:115727709-115727731 GTAATCTGCAGAAGATGGCACGG + Intergenic
996018555 5:118567826-118567848 GTTATCTGCAGAAGGTGGCAGGG - Intergenic
996164959 5:120212538-120212560 GTTATCTGCAGAAGATCTCAGGG + Intergenic
996392206 5:122973815-122973837 GTTATCTGCAGATGATGGCAGGG + Intronic
996488668 5:124066630-124066652 TTTATCTGCAAAAGGTAGCAGGG + Intergenic
996546790 5:124687855-124687877 GTTATATACAGAAGAAGACAAGG + Intronic
996704222 5:126480649-126480671 GTTTTCAGCAGAAGATGGATTGG - Exonic
996715930 5:126588040-126588062 GTTAGGTGCAGAGGCTGGCATGG + Intronic
996825559 5:127677805-127677827 ATTATCTGCAGAAGATGGCAGGG - Intergenic
997574033 5:134959182-134959204 TTTAGCTGCACAAGATGACAAGG - Intronic
997702831 5:135916364-135916386 GTTATATGCTGAAGATGGTTGGG + Intergenic
998290340 5:140908581-140908603 GTTAGCTGCAGAAGATGGAAGGG + Intronic
998592600 5:143493701-143493723 GTATTGGGCAGAAGATGGCAAGG - Intergenic
998735087 5:145128514-145128536 GTTTACTGCAGAGGATGGAAAGG - Intergenic
999935403 5:156480695-156480717 ATTATCTCCAGAAGAGAGCAGGG - Intronic
1000048907 5:157545262-157545284 TTTATCTCAAGAAGGTGGCATGG - Intronic
1000223250 5:159234278-159234300 GGTATCTGCAGAAGATGGCAGGG + Intergenic
1000354583 5:160381727-160381749 GTTATCTACAGAAGAGGGTGTGG - Intergenic
1000416969 5:160993872-160993894 GTTATCTACAGAAGATGGCAGGG - Intergenic
1000730199 5:164825686-164825708 GGTGTCTACAGAAGATGGGAGGG + Intergenic
1001005689 5:168047796-168047818 GCTATCTGCAGCAACTGGCATGG + Intronic
1001173591 5:169444613-169444635 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1001569994 5:172724415-172724437 GTGTTCTGCAGAAAATGTCAAGG + Intergenic
1001841459 5:174880454-174880476 GTTATATGAAGAAAAAGGCAAGG + Intergenic
1002910939 6:1490540-1490562 GCTATCTGCAGGAGATGAAAGGG + Intergenic
1002997962 6:2304717-2304739 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1003469925 6:6420104-6420126 GTTACCTGCAGATGGTGGAAGGG + Intergenic
1003695902 6:8406169-8406191 GTCATCTGCAGAAGATGGCAGGG + Intergenic
1003771891 6:9313897-9313919 GTAATCTGCTGAAGATCACAAGG + Intergenic
1003791216 6:9549962-9549984 GTTATCTTCAGAAGATGGTAGGG - Intergenic
1003806324 6:9729288-9729310 GTCATCTCCAAAAGATGGCATGG + Intronic
1004531829 6:16461279-16461301 GTTAACGGCAGAAGAGGGAAAGG + Intronic
1004824291 6:19403265-19403287 GTTATTTGCAGAAGATGGCAAGG + Intergenic
1005107222 6:22236716-22236738 GTGATGTGCAGCAGATGGCTTGG - Intergenic
1005225802 6:23640409-23640431 ATTATCTACAGAAGATGGCATGG + Intergenic
1005398783 6:25410460-25410482 GTTACCTGCCCAAGATTGCATGG + Intronic
1005886936 6:30104097-30104119 CTTACCTGCAGAAGATGACCCGG + Exonic
1006001552 6:30969046-30969068 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1006062348 6:31433193-31433215 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1007595981 6:43051525-43051547 CCTATCTGCAGAGGATGGTATGG - Intronic
1007905948 6:45460821-45460843 TTTTTCTGCTGAAGATGCCAAGG - Intronic
1008050705 6:46897944-46897966 ATCATCTGCAGAAGATGGATTGG - Intronic
1008079361 6:47178415-47178437 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1008400288 6:51055442-51055464 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1008722494 6:54373365-54373387 ATAATCTGTAGAAGATGCCAGGG - Intronic
1008820394 6:55625123-55625145 GTTATCTGCAGAAGACGGCTGGG - Intergenic
1008868031 6:56238656-56238678 GGTATCTGCTGAAGGTGGCAGGG - Intronic
1009308633 6:62122273-62122295 GTTATCTGCAGAAGATGGCAGGG - Intronic
1009345250 6:62607098-62607120 TTTATCTGGGGAAGACGGCATGG - Intergenic
1009390115 6:63135107-63135129 GTTATCTGCAGAAGATGACAGGG + Intergenic
1009660701 6:66606951-66606973 GTTATTTGCAGAAGAGGGCACGG + Intergenic
1009806491 6:68606923-68606945 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1009851929 6:69208987-69209009 GTTATCTGCAGAAGATGGCAGGG + Intronic
1010108013 6:72190935-72190957 GTTATCTGCAGAAGACAGCAGGG + Intronic
1010504830 6:76644332-76644354 GTTATGAGCAGAATATGCCATGG + Intergenic
1010818628 6:80388371-80388393 GTTATCTGCAGATAATGGCAGGG - Intergenic
1010931211 6:81805638-81805660 GTGATCTGCAGGAGTTGACAGGG - Intergenic
1011039348 6:83013303-83013325 GTTATCTGCAGAAGATGGCAGGG + Intronic
1011069097 6:83361636-83361658 TTTATCTGCAGAAGATGGCAGGG - Intronic
1012001904 6:93664420-93664442 GATATTTGCAGAAGATAGTAGGG - Intergenic
1012108575 6:95197766-95197788 GTTATCTGCAGAAGGTGGGAGGG + Intergenic
1012344584 6:98170290-98170312 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1012730457 6:102874290-102874312 GTTATCTGTAGAAGATGGCAGGG - Intergenic
1012820799 6:104082889-104082911 GTTATCTGCAGAAGATGGCCGGG - Intergenic
1013406667 6:109849773-109849795 GTTATCTGTAGAAGATGGCAGGG - Intergenic
1013497798 6:110715780-110715802 AGTTTCTGCCGAAGATGGCAGGG - Intronic
1013630251 6:111979637-111979659 GGGATTTGCAGAAGAAGGCAAGG + Intergenic
1013945884 6:115721713-115721735 GTTATCTGGAGGAGGTAGCAAGG - Intergenic
1014363403 6:120508383-120508405 GTTATCTGAAAAAGATGGCAGGG + Intergenic
1014416982 6:121195360-121195382 GTTATCTGCAGAAGATGGTAGGG - Intronic
1014534201 6:122596659-122596681 GTTATCTGCAGAAGATGGCAGGG + Intronic
1014538834 6:122649791-122649813 GCTGTCTTCAGAAGATGGCAGGG + Intronic
1014631637 6:123796772-123796794 GTTGTCTGCAGAAGATGGCAGGG - Intergenic
1014943369 6:127469624-127469646 GTTATAGGGAAAAGATGGCAAGG + Intronic
1015095454 6:129409630-129409652 GTGATCTGCAGAAGATGGCAGGG + Intronic
1015443290 6:133272594-133272616 GTTATCTGTAGAAGATGGTTGGG + Intronic
1015466852 6:133557746-133557768 GTTATCAGCAGAAGACGGCAGGG + Intergenic
1015475745 6:133657462-133657484 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1016119918 6:140332721-140332743 GTTATCTGCAGAAAATGGCAAGG + Intergenic
1016147333 6:140692745-140692767 GTTATCTGCAGAAGATGGCATGG + Intergenic
1016186983 6:141209335-141209357 GTTATCTGTTGAAGATGGTATGG + Intergenic
1016273431 6:142318808-142318830 GGTCTCTGCAGAAGAAGGTAGGG + Intronic
1016576262 6:145572616-145572638 GTTATCTGCAGAAAACGGCAGGG + Intronic
1016653764 6:146494176-146494198 GTTATTTCCAGAACATGCCATGG - Intergenic
1017977122 6:159368086-159368108 GTTATCTGCAGAAGATGGCTGGG + Intergenic
1018535036 6:164810523-164810545 GTTATATACAGAAGATGGCAGGG + Intergenic
1018599880 6:165527497-165527519 GTTATCTGGTGGAGATGGCAGGG - Intronic
1018803796 6:167243020-167243042 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1019118635 6:169785747-169785769 ATTATCTGCAGAAGAGGGTGTGG + Intergenic
1020396714 7:7725485-7725507 GTTATCTGCAAAAGATGGCATGG - Intronic
1020710345 7:11597596-11597618 GTTATCTGCAGAAGATGGCAGGG - Intronic
1021563869 7:21997675-21997697 GTTATCTACAAAGAATGGCAGGG + Intergenic
1022078883 7:27000303-27000325 AGTATCTGCAGAAGACAGCAGGG - Intergenic
1022539574 7:31123439-31123461 ATTGTCTGCAGAAGAGGGCAGGG - Intergenic
1024040533 7:45550115-45550137 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1024452587 7:49564315-49564337 GTGCTCTGCAGAGGATGGCCTGG - Intergenic
1024866098 7:53906314-53906336 GTTATCTGAAAAAGGTGGCAGGG - Intergenic
1024884346 7:54124684-54124706 GCTATCTAAAGAAGATGGCAGGG + Intergenic
1026046493 7:66909128-66909150 GTTATATGCAGAAGATGGCAGGG + Intergenic
1027685792 7:81277925-81277947 GTTATCTGCAGAAAATGGCAGGG - Intergenic
1027812880 7:82927902-82927924 GTTAGCTTCAGAAAATGGGAGGG + Intronic
1028043856 7:86091436-86091458 GTTATCTGCAGAAAAGGGCTGGG - Intergenic
1028141731 7:87281954-87281976 GTTATCTTCAGAAGATGGCAGGG - Intergenic
1028700392 7:93772162-93772184 GCTCTCAGCAGAAGCTGGCAAGG - Intronic
1028935009 7:96455033-96455055 ATTATCTGCAGAAGATGGCAGGG - Intergenic
1029178066 7:98679146-98679168 TTTGTGTGCAGAAGAAGGCAAGG - Intergenic
1030277454 7:107736084-107736106 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1030457466 7:109793082-109793104 GTTATCTGCAGAAGACGGCAAGG + Intergenic
1030479470 7:110084028-110084050 GTTTTCTGCAAAGGATGCCAGGG - Intergenic
1030931293 7:115525713-115525735 GTTATCTGCGGAAGATGGCAGGG + Intergenic
1030968744 7:116027127-116027149 GTTCTCTGCAGACATTGGCAGGG + Intronic
1031236823 7:119187985-119188007 GTTATCTGCAGAAGATGACAGGG - Intergenic
1031676554 7:124618319-124618341 GTTATCTGCAGAAAATGGCAGGG - Intergenic
1032153108 7:129446988-129447010 GTTATCTGCAGAAGATGGCAGGG + Intronic
1032712347 7:134471302-134471324 ATTATCTGCTGCTGATGGCATGG + Intergenic
1033677808 7:143561086-143561108 GTCATCTGCAGAAGATTCAATGG + Intergenic
1033694028 7:143768351-143768373 GTCATCTGCAGAAGATTCAATGG - Intergenic
1034517455 7:151591845-151591867 ATTATCTGCAGGAGAAGGCATGG - Intronic
1034864491 7:154629370-154629392 GTTATCTGCATGAGATGTCAGGG - Intronic
1036051742 8:5206423-5206445 CTTATCTGCAGCAGAAGCCAAGG - Intergenic
1036527351 8:9547550-9547572 GTTATCCACAGAGGATGGCAGGG + Intergenic
1037349727 8:17938961-17938983 GGTGTCTGAAGAAGATGGGAGGG + Exonic
1037364597 8:18108299-18108321 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1038342171 8:26695616-26695638 ATTACCTGAAGAAGAGGGCAAGG + Intergenic
1038449732 8:27632490-27632512 CATATATGCAGAAAATGGCAGGG - Intergenic
1039292314 8:36109913-36109935 GTTATCTACAGAGGATAGCAGGG + Intergenic
1039324175 8:36466556-36466578 GTTATCTACAGAAGATGTGAGGG + Intergenic
1039350575 8:36759403-36759425 GATGTCTGCAGATGATAGCAAGG - Intergenic
1040030988 8:42823461-42823483 TTTATCTGTGGATGATGGCAGGG + Intergenic
1040279706 8:46033257-46033279 GTAATCTGCAGATAACGGCAAGG - Intergenic
1040694297 8:49977763-49977785 GTCATAGGCAGAAGATGGAAAGG + Intronic
1040911942 8:52528387-52528409 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1041172226 8:55155814-55155836 GTTATCTGCTGTTGATGCCAGGG - Intronic
1041934550 8:63321299-63321321 GTTATCTGCAGAAGATGACAGGG - Intergenic
1042001068 8:64124027-64124049 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1042085616 8:65105669-65105691 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1042328615 8:67554990-67555012 GCTATCAGCAGAAGAGGGCTGGG + Intronic
1042342417 8:67694320-67694342 GTTATCTGCAGAAAATGGCAAGG - Intronic
1043259974 8:78184224-78184246 GCTATCTGCAGAAGATGACAGGG + Intergenic
1044192218 8:89332483-89332505 GTTAACTGAAGGAGATGTCACGG + Intergenic
1044202387 8:89452457-89452479 GTTATCTGCAAAAGATGACATGG - Intergenic
1044285976 8:90412477-90412499 GTTATCTGCAGAAGATGGTAGGG + Intergenic
1044487153 8:92767151-92767173 GTTATATGCAGAAGATGTCATGG + Intergenic
1044774738 8:95676533-95676555 GTTATCTGCAGAGAATGGCATGG - Intergenic
1045221834 8:100207036-100207058 GTTATCTGCAGAAGATGGCAGGG - Intronic
1046063988 8:109175193-109175215 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1046128678 8:109941633-109941655 GTTATCTGAAGAAGATTGTGGGG + Intergenic
1046197551 8:110884192-110884214 GTTATCTGCAGAAGAGGGCAGGG - Intergenic
1046417643 8:113937825-113937847 GTTGTCTGAAGAAGATGGCAGGG + Intergenic
1046522762 8:115346382-115346404 GTTATCTGCTGAAAGTGACAAGG + Intergenic
1046541418 8:115588509-115588531 TTTAACAGCAGAAGATGGTAGGG - Intronic
1046585789 8:116147750-116147772 GTTATTTGCAGAAGATGGCAGGG + Intergenic
1047453624 8:124989282-124989304 GTTATCTGTGGATGATAGCAGGG - Intergenic
1048642941 8:136384763-136384785 GTTATCCATAGAAGACGGCATGG - Intergenic
1050124449 9:2342265-2342287 ATTCTCTGCTGAAGAAGGCATGG - Intergenic
1050280136 9:4041826-4041848 CTTATGTGCAGAAAAAGGCAAGG - Intronic
1050482670 9:6102572-6102594 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1050619690 9:7439921-7439943 CTTTTCTGCTGCAGATGGCATGG - Intergenic
1052442273 9:28512313-28512335 GTTATCTGCAGAAGATGACAGGG + Intronic
1053391151 9:37737227-37737249 GGTATCTGCAGAAGAAGGTGAGG + Exonic
1053465960 9:38308749-38308771 GTTAACAGCAGATGTTGGCAAGG + Intergenic
1053695961 9:40639534-40639556 GTTAACTGGAGAAGATGACCGGG + Intergenic
1053942945 9:43270572-43270594 GTTAACTGGAGAAGATGACCAGG + Intergenic
1054162427 9:61683044-61683066 GATGTCAGCAGAAAATGGCAGGG + Intergenic
1054307208 9:63438752-63438774 GTTAACTGGAGAAGATGACCGGG + Intergenic
1055661542 9:78508683-78508705 GTTATCTGCAGAACAGGAAAAGG - Intergenic
1055678624 9:78691722-78691744 GTAATCTGCAGAGGATGACATGG + Intergenic
1055903945 9:81271235-81271257 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1056156661 9:83845178-83845200 GTTAGCTGCAGAAGATGGCGGGG - Intronic
1056241170 9:84647896-84647918 GTTATCAGCAGATTATGGTAGGG + Intergenic
1056314238 9:85372976-85372998 ATTATCTGCTGAAGATGGCAGGG + Intergenic
1056353877 9:85778349-85778371 GTTATCTGCAGAAGATGGCGGGG + Intergenic
1057004946 9:91548847-91548869 ATTATCTGCAGAGGATGAGAGGG + Intergenic
1057150530 9:92792340-92792362 GTGATCTGGGGAAGATGGCCGGG + Intergenic
1057864092 9:98665651-98665673 GTTCTCTGCTGCAGATGGCATGG - Intronic
1058019892 9:100076049-100076071 GTTATCTGCAGAAGATGGCAGGG - Intronic
1058259261 9:102809699-102809721 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1058544170 9:106042783-106042805 TATATCTGCAGAAGATGGCAGGG + Intergenic
1059196509 9:112375899-112375921 GTTATCTGCAGAAGAAGGCAGGG + Intergenic
1059831662 9:118102980-118103002 ATCATCTGCAGAAGTAGGCATGG - Intergenic
1060178777 9:121517286-121517308 GTTATGTGCAGATGATGGCAAGG - Intergenic
1062135466 9:134924992-134925014 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1202778408 9_KI270717v1_random:13147-13169 GTTAACTGGAGAAGATGACCGGG + Intergenic
1186279491 X:7977087-7977109 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1186384098 X:9091793-9091815 GTTATCTGCAGAAGATGGCAGGG + Intronic
1186469771 X:9812140-9812162 GTTGTCTGCAGAAGATGGCAGGG + Intronic
1186479763 X:9887725-9887747 GTTATCTGCACATGATAGAAGGG + Intronic
1186811157 X:13190146-13190168 TGTGTCTGCAGAAGATGGCATGG - Intergenic
1187604861 X:20871831-20871853 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1188000496 X:24975885-24975907 GTTATCAGCAGTAGACGTCAAGG + Intronic
1188764480 X:34075206-34075228 GCTATCCACAGAGGATGGCAAGG - Intergenic
1189063810 X:37784471-37784493 TCTATGTGGAGAAGATGGCATGG + Intronic
1189154888 X:38746753-38746775 GTTATTTGCAGAAGATGGCAGGG + Intergenic
1190113747 X:47612200-47612222 ATTCTCTGCTGCAGATGGCATGG - Intronic
1190255268 X:48757772-48757794 GTTATCTGCAGAGAATAGCAGGG - Intergenic
1190527883 X:51346280-51346302 GTTATATGCAGAGCATGGCAGGG + Intergenic
1190996752 X:55617500-55617522 GTTATCTACAGAAGATGGCAGGG + Intergenic
1191095710 X:56671206-56671228 GTTATCTGTGGAAGATAGCAGGG + Intergenic
1191630041 X:63312620-63312642 GTTATCTGAAGAAGTTGACAGGG + Intergenic
1191658809 X:63629838-63629860 GTTATCTGCTGAAGATGGCAGGG + Intergenic
1191719245 X:64215741-64215763 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1191742545 X:64451340-64451362 GTTATCTGCAGAAGATGGCAAGG + Intergenic
1191759357 X:64629892-64629914 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1191769501 X:64740130-64740152 GTTATTTGCAGAAGAAGGCAGGG + Intergenic
1191790010 X:64960073-64960095 GTGATCTCCAAAAGATGGAAAGG + Intronic
1191932923 X:66394129-66394151 GTTATCTGCAGAAGACAGCAGGG - Intergenic
1191940886 X:66480797-66480819 GTTATCTGCAAACTATTGCAGGG - Intergenic
1191946351 X:66538979-66539001 ATTATCTGCAAAAGATGACTAGG - Intergenic
1192297715 X:69868048-69868070 GTTATCTGCAGAAGATGGCAGGG + Intronic
1192614586 X:72606443-72606465 GTAATCCAAAGAAGATGGCATGG - Intronic
1192673257 X:73168449-73168471 GTTACCTGCAGAAGATGGCAGGG + Intergenic
1192898699 X:75471877-75471899 GTTATCTGCAGAAGATGGCAGGG - Intronic
1192996188 X:76515545-76515567 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1193053486 X:77125735-77125757 GTTTTCTGCAGAAGATGGCAGGG - Intergenic
1193184301 X:78494134-78494156 GGAATCTACAGAAGATTGCAAGG - Intergenic
1193297776 X:79852641-79852663 GTTATGTGCAGATGATGGCAGGG - Intergenic
1193356252 X:80523092-80523114 GTTATCTGCAGAAGACAGTAGGG - Intergenic
1193447151 X:81618738-81618760 GTTATCTGCAGGAGATGGCAGGG - Intergenic
1193464940 X:81836825-81836847 GTTATCTACAGAGGATGACAAGG + Intergenic
1193598389 X:83477219-83477241 GCCATTTGCAGAAGATGGAAGGG + Intergenic
1193904482 X:87225798-87225820 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1193914805 X:87351961-87351983 GTTATCTGCAGAAGATGGCAAGG + Intergenic
1193957279 X:87878177-87878199 GTTATCTGCAGAAGGTGGCAGGG - Intergenic
1194179595 X:90695968-90695990 GTTATCTGAAGAAGATGGCAGGG + Intergenic
1194210274 X:91062321-91062343 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1194443545 X:93961070-93961092 GTTATCTGCAGAAGATGGAAGGG - Intergenic
1194480453 X:94415323-94415345 GATATCCACAGAGGATGGCATGG + Intergenic
1194513421 X:94822285-94822307 GTTATCTGCAGAAGATGACAGGG + Intergenic
1194521078 X:94919406-94919428 GTTATCTGCAAAAGATGACAGGG - Intergenic
1194649418 X:96497839-96497861 GTTATCTGTAGATAATGGCAGGG - Intergenic
1194849250 X:98852207-98852229 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1195228464 X:102822238-102822260 GTTATCTAGGAAAGATGGCAGGG - Intergenic
1195782358 X:108479898-108479920 GTTTTTTGCAGAGGATGGCAGGG + Intronic
1196135973 X:112209876-112209898 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1197002283 X:121452888-121452910 GTTATCTGCAGAAGATGACAGGG - Intergenic
1197084201 X:122453532-122453554 GTTATCTGCAAAGGATGGCAAGG + Intergenic
1197097463 X:122612805-122612827 GTTATCTGCAGAAGATGGTAGGG - Intergenic
1197245050 X:124159027-124159049 GTTATCTGCAGAAGATGGCAGGG + Intronic
1197372061 X:125637899-125637921 GTTACCTGCAGAAGATGGCAGGG + Intergenic
1197380004 X:125727938-125727960 GTTTTCTGCAGAAGATGGCAGGG + Intergenic
1197386777 X:125812276-125812298 GATATCTGCAGTAGATTGCAGGG + Intergenic
1197477362 X:126941362-126941384 GTTATCTGCATAAGATGACAGGG + Intergenic
1197521992 X:127510338-127510360 GTTATCTGTAGATGGTGGCAGGG - Intergenic
1197591863 X:128419354-128419376 GTTATCTGCAGAAGATGACTGGG - Intergenic
1198147163 X:133868783-133868805 GTTATCAGCAGAGGAAGGGAGGG - Intronic
1198169998 X:134096221-134096243 GTTATCTGTGGAGGATGGCAGGG - Intergenic
1198591757 X:138190816-138190838 CATATCTGAAGAAGCTGGCAAGG + Intergenic
1198701295 X:139400263-139400285 GTTATCTGCAGAAAATGGAAGGG - Intergenic
1198753284 X:139956628-139956650 CTTGTCTGCAGTAGATAGCATGG + Exonic
1198934037 X:141887846-141887868 GTTATCTGCAGAAGATTGAAGGG - Intronic
1199144446 X:144348998-144349020 GGTATCTGAAGAAGATAGCAGGG + Intergenic
1199310430 X:146314433-146314455 GTTATCTGCAGAAGAAGGCAAGG + Intergenic
1199499109 X:148489753-148489775 GTTCTCTGCAGAAGTTCCCAAGG - Intergenic
1199661483 X:150054778-150054800 AATATCTGCAGAACATAGCAGGG + Intergenic
1200340498 X:155390673-155390695 GTTATCTGCAGAAGATGACAGGG + Intergenic
1200521267 Y:4211997-4212019 GTTATCTGCAGAAGATTTCAGGG - Intergenic
1200526257 Y:4278137-4278159 GTTATCTGAAGAAGATGGCAGGG + Intergenic
1200651666 Y:5847716-5847738 GTTATCTGCAGAAGATGGCAAGG - Intergenic
1200709923 Y:6474114-6474136 GGTGTCTGCAAAAGATGGCTGGG + Intergenic
1200746062 Y:6904905-6904927 GTTACCCACAGAAGATGGCAGGG + Intergenic
1200962878 Y:9011219-9011241 GGTGTCTGCAAAAGATGGCTGGG - Intergenic
1200973128 Y:9177743-9177765 TTTATCTACAGAAGATGGCAGGG + Intergenic
1201024192 Y:9690594-9690616 GGTGTCTGCAAAAGATGGCTGGG - Intergenic
1201193722 Y:11471450-11471472 GTTAACTGGAGAAGATGACAGGG + Intergenic
1201303817 Y:12533789-12533811 GTTATCTGCACATTATGGAAGGG + Intergenic
1201529655 Y:14977927-14977949 GTTATCTGCAGACTATGACAAGG + Intergenic
1201765800 Y:17572652-17572674 GTTATCTGCAGATAATGGCAGGG - Intergenic
1201796634 Y:17903444-17903466 GTTATCTGCAGAAAATGGCAGGG + Intergenic
1201804921 Y:18002541-18002563 GTTATCTGCAGAAAATGGCAGGG - Intergenic
1201835752 Y:18333337-18333359 GTTATCTGCAGATAATGGCAGGG + Intergenic
1202137950 Y:21686770-21686792 TTTGTCTACAGAAGATGGCAGGG - Intergenic
1202150228 Y:21837562-21837584 GGTGTCTGCAAAAGATGGCTGGG + Intergenic
1202177214 Y:22108820-22108842 GTTGTCAGCAAAAGATGGCCGGG + Intergenic
1202214147 Y:22477564-22477586 GTTGTCAGCAAAAGATGGCCGGG - Intergenic
1202358018 Y:24072506-24072528 GTTATCTGCAGAAAATGGCAGGG + Intergenic
1202359742 Y:24095356-24095378 GTTATCTGCAGAAGATGGCAGGG - Intergenic
1202511036 Y:25574758-25574780 GTTATCTGCAGAAGATGGCAGGG + Intergenic
1202512760 Y:25597607-25597629 GTTATCTGCAGAAAATGGCAGGG - Intergenic