ID: 1117216844

View in Genome Browser
Species Human (GRCh38)
Location 14:53560186-53560208
Sequence GACACCTCTTGGCCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117216841_1117216844 11 Left 1117216841 14:53560152-53560174 CCATCTTCTGCAGATAACTACTC 0: 178
1: 192
2: 102
3: 110
4: 247
Right 1117216844 14:53560186-53560208 GACACCTCTTGGCCTGTTACTGG No data
1117216839_1117216844 16 Left 1117216839 14:53560147-53560169 CCCTGCCATCTTCTGCAGATAAC 0: 180
1: 172
2: 120
3: 86
4: 284
Right 1117216844 14:53560186-53560208 GACACCTCTTGGCCTGTTACTGG No data
1117216840_1117216844 15 Left 1117216840 14:53560148-53560170 CCTGCCATCTTCTGCAGATAACT 0: 185
1: 187
2: 104
3: 111
4: 225
Right 1117216844 14:53560186-53560208 GACACCTCTTGGCCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117216844 Original CRISPR GACACCTCTTGGCCTGTTAC TGG Intergenic
No off target data available for this crispr