ID: 1117221866

View in Genome Browser
Species Human (GRCh38)
Location 14:53614145-53614167
Sequence AGTGCTCTGTCTCTATTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117221865_1117221866 -10 Left 1117221865 14:53614132-53614154 CCTACATCAGTCGAGTGCTCTGT No data
Right 1117221866 14:53614145-53614167 AGTGCTCTGTCTCTATTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117221866 Original CRISPR AGTGCTCTGTCTCTATTTGA TGG Intergenic
No off target data available for this crispr