ID: 1117225242

View in Genome Browser
Species Human (GRCh38)
Location 14:53651691-53651713
Sequence CATTAACAGCTCTGAGAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117225242_1117225246 18 Left 1117225242 14:53651691-53651713 CCCTATTCTCAGAGCTGTTAATG No data
Right 1117225246 14:53651732-53651754 AGTCTTTCAGTCATCTCGGCAGG No data
1117225242_1117225245 14 Left 1117225242 14:53651691-53651713 CCCTATTCTCAGAGCTGTTAATG No data
Right 1117225245 14:53651728-53651750 TGTAAGTCTTTCAGTCATCTCGG No data
1117225242_1117225248 23 Left 1117225242 14:53651691-53651713 CCCTATTCTCAGAGCTGTTAATG No data
Right 1117225248 14:53651737-53651759 TTCAGTCATCTCGGCAGGTTGGG No data
1117225242_1117225249 27 Left 1117225242 14:53651691-53651713 CCCTATTCTCAGAGCTGTTAATG No data
Right 1117225249 14:53651741-53651763 GTCATCTCGGCAGGTTGGGTAGG No data
1117225242_1117225250 28 Left 1117225242 14:53651691-53651713 CCCTATTCTCAGAGCTGTTAATG No data
Right 1117225250 14:53651742-53651764 TCATCTCGGCAGGTTGGGTAGGG No data
1117225242_1117225247 22 Left 1117225242 14:53651691-53651713 CCCTATTCTCAGAGCTGTTAATG No data
Right 1117225247 14:53651736-53651758 TTTCAGTCATCTCGGCAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117225242 Original CRISPR CATTAACAGCTCTGAGAATA GGG (reversed) Intergenic
No off target data available for this crispr