ID: 1117225244

View in Genome Browser
Species Human (GRCh38)
Location 14:53651724-53651746
Sequence GATGACTGAAAGACTTACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117225244_1117225249 -6 Left 1117225244 14:53651724-53651746 CCTTTGTAAGTCTTTCAGTCATC No data
Right 1117225249 14:53651741-53651763 GTCATCTCGGCAGGTTGGGTAGG No data
1117225244_1117225248 -10 Left 1117225244 14:53651724-53651746 CCTTTGTAAGTCTTTCAGTCATC No data
Right 1117225248 14:53651737-53651759 TTCAGTCATCTCGGCAGGTTGGG No data
1117225244_1117225251 -2 Left 1117225244 14:53651724-53651746 CCTTTGTAAGTCTTTCAGTCATC No data
Right 1117225251 14:53651745-53651767 TCTCGGCAGGTTGGGTAGGGAGG No data
1117225244_1117225250 -5 Left 1117225244 14:53651724-53651746 CCTTTGTAAGTCTTTCAGTCATC No data
Right 1117225250 14:53651742-53651764 TCATCTCGGCAGGTTGGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117225244 Original CRISPR GATGACTGAAAGACTTACAA AGG (reversed) Intergenic
No off target data available for this crispr