ID: 1117225248

View in Genome Browser
Species Human (GRCh38)
Location 14:53651737-53651759
Sequence TTCAGTCATCTCGGCAGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117225243_1117225248 22 Left 1117225243 14:53651692-53651714 CCTATTCTCAGAGCTGTTAATGA No data
Right 1117225248 14:53651737-53651759 TTCAGTCATCTCGGCAGGTTGGG No data
1117225244_1117225248 -10 Left 1117225244 14:53651724-53651746 CCTTTGTAAGTCTTTCAGTCATC No data
Right 1117225248 14:53651737-53651759 TTCAGTCATCTCGGCAGGTTGGG No data
1117225242_1117225248 23 Left 1117225242 14:53651691-53651713 CCCTATTCTCAGAGCTGTTAATG No data
Right 1117225248 14:53651737-53651759 TTCAGTCATCTCGGCAGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117225248 Original CRISPR TTCAGTCATCTCGGCAGGTT GGG Intergenic
No off target data available for this crispr