ID: 1117229799

View in Genome Browser
Species Human (GRCh38)
Location 14:53705107-53705129
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117229792_1117229799 4 Left 1117229792 14:53705080-53705102 CCAATTAAGTTACAGCATCATTT No data
Right 1117229799 14:53705107-53705129 TTAAATAAGAAGGAGGGGGAGGG No data
1117229791_1117229799 27 Left 1117229791 14:53705057-53705079 CCTTTCAGAATAGTATTATGGTG No data
Right 1117229799 14:53705107-53705129 TTAAATAAGAAGGAGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117229799 Original CRISPR TTAAATAAGAAGGAGGGGGA GGG Intergenic