ID: 1117240844

View in Genome Browser
Species Human (GRCh38)
Location 14:53830721-53830743
Sequence CTGGTGTTCCTGAGGAAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117240837_1117240844 21 Left 1117240837 14:53830677-53830699 CCAAGAAATTTAGGATTCTATTA No data
Right 1117240844 14:53830721-53830743 CTGGTGTTCCTGAGGAAGAAGGG No data
1117240840_1117240844 -7 Left 1117240840 14:53830705-53830727 CCAAACCTAAGAATAACTGGTGT 0: 30
1: 333
2: 454
3: 507
4: 736
Right 1117240844 14:53830721-53830743 CTGGTGTTCCTGAGGAAGAAGGG No data
1117240836_1117240844 24 Left 1117240836 14:53830674-53830696 CCTCCAAGAAATTTAGGATTCTA No data
Right 1117240844 14:53830721-53830743 CTGGTGTTCCTGAGGAAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117240844 Original CRISPR CTGGTGTTCCTGAGGAAGAA GGG Intergenic
No off target data available for this crispr