ID: 1117242152 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:53844896-53844918 |
| Sequence | TAGGCCTTGAATCAGATTTC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1117242152_1117242157 | 26 | Left | 1117242152 | 14:53844896-53844918 | CCAGAAATCTGATTCAAGGCCTA | No data | ||
| Right | 1117242157 | 14:53844945-53844967 | TCATTTTGATCTCAAGGACAAGG | No data | ||||
| 1117242152_1117242153 | -8 | Left | 1117242152 | 14:53844896-53844918 | CCAGAAATCTGATTCAAGGCCTA | No data | ||
| Right | 1117242153 | 14:53844911-53844933 | AAGGCCTAACTATAGCTAGATGG | No data | ||||
| 1117242152_1117242155 | 20 | Left | 1117242152 | 14:53844896-53844918 | CCAGAAATCTGATTCAAGGCCTA | No data | ||
| Right | 1117242155 | 14:53844939-53844961 | AATGCCTCATTTTGATCTCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1117242152 | Original CRISPR | TAGGCCTTGAATCAGATTTC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||