ID: 1117242152

View in Genome Browser
Species Human (GRCh38)
Location 14:53844896-53844918
Sequence TAGGCCTTGAATCAGATTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117242152_1117242157 26 Left 1117242152 14:53844896-53844918 CCAGAAATCTGATTCAAGGCCTA No data
Right 1117242157 14:53844945-53844967 TCATTTTGATCTCAAGGACAAGG No data
1117242152_1117242153 -8 Left 1117242152 14:53844896-53844918 CCAGAAATCTGATTCAAGGCCTA No data
Right 1117242153 14:53844911-53844933 AAGGCCTAACTATAGCTAGATGG No data
1117242152_1117242155 20 Left 1117242152 14:53844896-53844918 CCAGAAATCTGATTCAAGGCCTA No data
Right 1117242155 14:53844939-53844961 AATGCCTCATTTTGATCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117242152 Original CRISPR TAGGCCTTGAATCAGATTTC TGG (reversed) Intergenic
No off target data available for this crispr