ID: 1117242153

View in Genome Browser
Species Human (GRCh38)
Location 14:53844911-53844933
Sequence AAGGCCTAACTATAGCTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117242150_1117242153 -4 Left 1117242150 14:53844892-53844914 CCAACCAGAAATCTGATTCAAGG No data
Right 1117242153 14:53844911-53844933 AAGGCCTAACTATAGCTAGATGG No data
1117242152_1117242153 -8 Left 1117242152 14:53844896-53844918 CCAGAAATCTGATTCAAGGCCTA No data
Right 1117242153 14:53844911-53844933 AAGGCCTAACTATAGCTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117242153 Original CRISPR AAGGCCTAACTATAGCTAGA TGG Intergenic
No off target data available for this crispr