ID: 1117242153 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14:53844911-53844933 |
Sequence | AAGGCCTAACTATAGCTAGA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1117242150_1117242153 | -4 | Left | 1117242150 | 14:53844892-53844914 | CCAACCAGAAATCTGATTCAAGG | No data | ||
Right | 1117242153 | 14:53844911-53844933 | AAGGCCTAACTATAGCTAGATGG | No data | ||||
1117242152_1117242153 | -8 | Left | 1117242152 | 14:53844896-53844918 | CCAGAAATCTGATTCAAGGCCTA | No data | ||
Right | 1117242153 | 14:53844911-53844933 | AAGGCCTAACTATAGCTAGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1117242153 | Original CRISPR | AAGGCCTAACTATAGCTAGA TGG | Intergenic | ||
No off target data available for this crispr |