ID: 1117242154

View in Genome Browser
Species Human (GRCh38)
Location 14:53844915-53844937
Sequence CATGCCATCTAGCTATAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117242154_1117242155 1 Left 1117242154 14:53844915-53844937 CCTAACTATAGCTAGATGGCATG No data
Right 1117242155 14:53844939-53844961 AATGCCTCATTTTGATCTCAAGG No data
1117242154_1117242157 7 Left 1117242154 14:53844915-53844937 CCTAACTATAGCTAGATGGCATG No data
Right 1117242157 14:53844945-53844967 TCATTTTGATCTCAAGGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117242154 Original CRISPR CATGCCATCTAGCTATAGTT AGG (reversed) Intergenic
No off target data available for this crispr