ID: 1117242155

View in Genome Browser
Species Human (GRCh38)
Location 14:53844939-53844961
Sequence AATGCCTCATTTTGATCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117242154_1117242155 1 Left 1117242154 14:53844915-53844937 CCTAACTATAGCTAGATGGCATG No data
Right 1117242155 14:53844939-53844961 AATGCCTCATTTTGATCTCAAGG No data
1117242150_1117242155 24 Left 1117242150 14:53844892-53844914 CCAACCAGAAATCTGATTCAAGG No data
Right 1117242155 14:53844939-53844961 AATGCCTCATTTTGATCTCAAGG No data
1117242152_1117242155 20 Left 1117242152 14:53844896-53844918 CCAGAAATCTGATTCAAGGCCTA No data
Right 1117242155 14:53844939-53844961 AATGCCTCATTTTGATCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117242155 Original CRISPR AATGCCTCATTTTGATCTCA AGG Intergenic
No off target data available for this crispr