ID: 1117242526

View in Genome Browser
Species Human (GRCh38)
Location 14:53849135-53849157
Sequence CCAACTATGCTCCCCAGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117242526_1117242534 2 Left 1117242526 14:53849135-53849157 CCTACCCTGGGGAGCATAGTTGG No data
Right 1117242534 14:53849160-53849182 ATGGGGTGAAGTTCAAAGATGGG No data
1117242526_1117242533 1 Left 1117242526 14:53849135-53849157 CCTACCCTGGGGAGCATAGTTGG No data
Right 1117242533 14:53849159-53849181 GATGGGGTGAAGTTCAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117242526 Original CRISPR CCAACTATGCTCCCCAGGGT AGG (reversed) Intergenic
No off target data available for this crispr