ID: 1117247719

View in Genome Browser
Species Human (GRCh38)
Location 14:53902268-53902290
Sequence GGGCCCTCTGGACCAAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117247719_1117247724 12 Left 1117247719 14:53902268-53902290 CCATCTTTTGGTCCAGAGGGCCC No data
Right 1117247724 14:53902303-53902325 CTCAGGCCTTAAGCAAAGCCAGG No data
1117247719_1117247721 -5 Left 1117247719 14:53902268-53902290 CCATCTTTTGGTCCAGAGGGCCC No data
Right 1117247721 14:53902286-53902308 GGCCCATACATTTCAGTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117247719 Original CRISPR GGGCCCTCTGGACCAAAAGA TGG (reversed) Intergenic
No off target data available for this crispr