ID: 1117252174

View in Genome Browser
Species Human (GRCh38)
Location 14:53948888-53948910
Sequence TGGGATCCTAAACTTGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117252163_1117252174 8 Left 1117252163 14:53948857-53948879 CCATTGTCAACCCCCACCCAGCC No data
Right 1117252174 14:53948888-53948910 TGGGATCCTAAACTTGATGAAGG No data
1117252167_1117252174 -4 Left 1117252167 14:53948869-53948891 CCCACCCAGCCCAATCTGTTGGG No data
Right 1117252174 14:53948888-53948910 TGGGATCCTAAACTTGATGAAGG No data
1117252169_1117252174 -5 Left 1117252169 14:53948870-53948892 CCACCCAGCCCAATCTGTTGGGA No data
Right 1117252174 14:53948888-53948910 TGGGATCCTAAACTTGATGAAGG No data
1117252159_1117252174 25 Left 1117252159 14:53948840-53948862 CCCTTTAGTATCTGACCCCATTG No data
Right 1117252174 14:53948888-53948910 TGGGATCCTAAACTTGATGAAGG No data
1117252164_1117252174 -2 Left 1117252164 14:53948867-53948889 CCCCCACCCAGCCCAATCTGTTG No data
Right 1117252174 14:53948888-53948910 TGGGATCCTAAACTTGATGAAGG No data
1117252171_1117252174 -9 Left 1117252171 14:53948874-53948896 CCAGCCCAATCTGTTGGGATCCT No data
Right 1117252174 14:53948888-53948910 TGGGATCCTAAACTTGATGAAGG No data
1117252162_1117252174 9 Left 1117252162 14:53948856-53948878 CCCATTGTCAACCCCCACCCAGC No data
Right 1117252174 14:53948888-53948910 TGGGATCCTAAACTTGATGAAGG No data
1117252160_1117252174 24 Left 1117252160 14:53948841-53948863 CCTTTAGTATCTGACCCCATTGT No data
Right 1117252174 14:53948888-53948910 TGGGATCCTAAACTTGATGAAGG No data
1117252165_1117252174 -3 Left 1117252165 14:53948868-53948890 CCCCACCCAGCCCAATCTGTTGG No data
Right 1117252174 14:53948888-53948910 TGGGATCCTAAACTTGATGAAGG No data
1117252161_1117252174 10 Left 1117252161 14:53948855-53948877 CCCCATTGTCAACCCCCACCCAG No data
Right 1117252174 14:53948888-53948910 TGGGATCCTAAACTTGATGAAGG No data
1117252170_1117252174 -8 Left 1117252170 14:53948873-53948895 CCCAGCCCAATCTGTTGGGATCC No data
Right 1117252174 14:53948888-53948910 TGGGATCCTAAACTTGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117252174 Original CRISPR TGGGATCCTAAACTTGATGA AGG Intergenic
No off target data available for this crispr