ID: 1117253234

View in Genome Browser
Species Human (GRCh38)
Location 14:53955102-53955124
Sequence GTCCCGCGCCACCGCTGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 83}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117253221_1117253234 29 Left 1117253221 14:53955050-53955072 CCTGCGCGACCGTCCGCGCCCGG 0: 1
1: 0
2: 0
3: 16
4: 196
Right 1117253234 14:53955102-53955124 GTCCCGCGCCACCGCTGGGGCGG 0: 1
1: 0
2: 0
3: 7
4: 83
1117253226_1117253234 11 Left 1117253226 14:53955068-53955090 CCCGGCAAGAGCCGCGCGGCTTT 0: 1
1: 0
2: 0
3: 4
4: 26
Right 1117253234 14:53955102-53955124 GTCCCGCGCCACCGCTGGGGCGG 0: 1
1: 0
2: 0
3: 7
4: 83
1117253220_1117253234 30 Left 1117253220 14:53955049-53955071 CCCTGCGCGACCGTCCGCGCCCG 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1117253234 14:53955102-53955124 GTCCCGCGCCACCGCTGGGGCGG 0: 1
1: 0
2: 0
3: 7
4: 83
1117253227_1117253234 10 Left 1117253227 14:53955069-53955091 CCGGCAAGAGCCGCGCGGCTTTC 0: 1
1: 0
2: 0
3: 6
4: 29
Right 1117253234 14:53955102-53955124 GTCCCGCGCCACCGCTGGGGCGG 0: 1
1: 0
2: 0
3: 7
4: 83
1117253223_1117253234 20 Left 1117253223 14:53955059-53955081 CCGTCCGCGCCCGGCAAGAGCCG 0: 1
1: 0
2: 0
3: 4
4: 52
Right 1117253234 14:53955102-53955124 GTCCCGCGCCACCGCTGGGGCGG 0: 1
1: 0
2: 0
3: 7
4: 83
1117253228_1117253234 0 Left 1117253228 14:53955079-53955101 CCGCGCGGCTTTCGCCTTTGCTG 0: 1
1: 0
2: 0
3: 8
4: 100
Right 1117253234 14:53955102-53955124 GTCCCGCGCCACCGCTGGGGCGG 0: 1
1: 0
2: 0
3: 7
4: 83
1117253224_1117253234 16 Left 1117253224 14:53955063-53955085 CCGCGCCCGGCAAGAGCCGCGCG 0: 1
1: 0
2: 0
3: 11
4: 113
Right 1117253234 14:53955102-53955124 GTCCCGCGCCACCGCTGGGGCGG 0: 1
1: 0
2: 0
3: 7
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117253234 Original CRISPR GTCCCGCGCCACCGCTGGGG CGG Intronic
902747006 1:18481111-18481133 TTCCCACCCCACCGCTGGGCTGG - Exonic
904485939 1:30824608-30824630 GGCCGGCGCCCCCGCCGGGGCGG + Intergenic
904641996 1:31938109-31938131 GTCGCGCGCCGAGGCTGGGGGGG - Exonic
905179173 1:36156071-36156093 GTCCCGGGGCGCTGCTGGGGTGG + Intronic
908387159 1:63653676-63653698 GTCCAGAGATACCGCTGGGGAGG + Intronic
1063504018 10:6580176-6580198 GCCCCGCGCCGCCGCCGGGAGGG - Intronic
1066370634 10:34815520-34815542 GTCCCGCGCCCCCGGAGGGAGGG - Intergenic
1066689300 10:38010820-38010842 GCCCCGCGCGACTCCTGGGGCGG + Intronic
1069419153 10:68231196-68231218 GGCGCGCGCCTCCGCGGGGGTGG - Exonic
1071568064 10:86681629-86681651 GTCCCGGGCCCCCTCTGGGCTGG - Exonic
1075976900 10:126703932-126703954 GTCCCACTTCACAGCTGGGGAGG + Intergenic
1077303046 11:1855914-1855936 GTCCTGGTCCACAGCTGGGGAGG + Intronic
1080642119 11:34164206-34164228 GTCCCGCCACACCCCTGGGCAGG + Intronic
1083670884 11:64299470-64299492 GTCCAGCGCAGCCGCTGGGCAGG + Exonic
1091718231 12:2794918-2794940 GTCCCGCCCCGCCGCGAGGGAGG - Intergenic
1097057271 12:56257747-56257769 GAGCCGCCCCACCGGTGGGGAGG + Intronic
1113779731 13:112969198-112969220 GTTCCGCGCCACCGGGAGGGGGG - Intronic
1114483207 14:23047946-23047968 GGCCCGGCCCACCGCGGGGGGGG - Exonic
1115469488 14:33754094-33754116 GCCCCGCGACCCCACTGGGGTGG + Intronic
1117253234 14:53955102-53955124 GTCCCGCGCCACCGCTGGGGCGG + Intronic
1121168826 14:91836324-91836346 GTCCCACGCCCGCGCTGGGCCGG + Intronic
1128655985 15:69462413-69462435 TTCACGCGCCAGCGCTGGAGAGG - Intergenic
1133186992 16:4107158-4107180 GTTCCCCTCCACAGCTGGGGTGG - Intronic
1141910176 16:87053342-87053364 GTCCCCCGCCAGCCTTGGGGGGG - Intergenic
1142293332 16:89202528-89202550 GTCCCGCAACACTGTTGGGGGGG - Intergenic
1142376873 16:89711139-89711161 GCCCCCCGCCCCCGCTGGGGAGG + Intronic
1142492119 17:286035-286057 TCCCCCCGCCACTGCTGGGGGGG + Intronic
1143108391 17:4540729-4540751 GGCCCGGGCCACTGCTGGAGGGG - Intronic
1147662733 17:42125679-42125701 GACTCGGGCCACCACTGGGGGGG - Exonic
1155053825 18:22169044-22169066 GTCCCGCGCCGCCGCCGCGGCGG - Intergenic
1155680505 18:28480972-28480994 GTCTTGTGCCAACGCTGGGGTGG + Intergenic
1160869253 19:1269529-1269551 GTCCCTCGCCGCCGGCGGGGCGG - Intronic
1161101884 19:2425523-2425545 GTCCCGCCCAGCCGCCGGGGAGG + Intronic
1162962653 19:14136963-14136985 GCCGCGCGCCACCGCTCGGCGGG - Intergenic
1163720491 19:18896143-18896165 GTCACGCGCCGCAGCTGGGCCGG + Intronic
1163721610 19:18900545-18900567 GTCCCACCCCACCTCTGAGGAGG - Intronic
1166361413 19:42254279-42254301 CTCCCGCGCCACCGGTGGCCCGG - Intronic
1168327219 19:55544613-55544635 GTCCCTCGCCCTCTCTGGGGTGG + Intronic
925182105 2:1824000-1824022 GCCCGGCGGCCCCGCTGGGGGGG - Intronic
927652311 2:24920088-24920110 GGCCCGCGCTCCCGCCGGGGAGG - Intergenic
936104547 2:109613801-109613823 GTGCCGCGCCACCTCGGAGGAGG + Exonic
943782082 2:191836159-191836181 GTCCCTCGCCAGCGCTCTGGTGG - Exonic
944451750 2:199850921-199850943 GTCCCGCGAGACCTGTGGGGAGG - Exonic
948046876 2:234951966-234951988 GTCCCGCGCCTGGGCGGGGGCGG - Intronic
948835409 2:240623936-240623958 GCCCCAGGCCACTGCTGGGGAGG + Intronic
1172787527 20:37479070-37479092 GTCCTGTGCCCACGCTGGGGTGG + Intergenic
1172840180 20:37898086-37898108 CTCCCGCCCCACCACTGTGGTGG - Intergenic
1173657425 20:44709975-44709997 GTCCCAAGCCGACGCTGGGGAGG - Intergenic
1175966305 20:62661717-62661739 GTCCCGCTCACCCTCTGGGGAGG + Intronic
1176077286 20:63254271-63254293 GTCCCGCGCCAGCTCCGAGGGGG - Intronic
1180953007 22:19729197-19729219 GTGCCAGGCCACCGCTGGGGAGG - Intergenic
1183080490 22:35452718-35452740 GTCCGACTCCTCCGCTGGGGTGG + Intergenic
1185289137 22:50015270-50015292 GTCCCTCGGCAGCCCTGGGGAGG + Exonic
951907265 3:27717569-27717591 GTGACAAGCCACCGCTGGGGAGG + Exonic
953748722 3:45594088-45594110 GTCCCGAGCCCGCGCCGGGGCGG - Intronic
959849824 3:111072388-111072410 GACCCGCGCGGCCGCGGGGGAGG - Intronic
962891707 3:139677990-139678012 GCCCCGCCCCTTCGCTGGGGCGG + Exonic
968651930 4:1763585-1763607 GGCCAGCGCCACCGCAGGGCGGG + Intergenic
969474315 4:7412672-7412694 GCCCCTCCCCACCCCTGGGGCGG + Intronic
977894063 4:102344775-102344797 GTCCCGCGCCACCTCTGACTCGG - Exonic
987310083 5:16673681-16673703 CTCCCACACCACCGCTGGGGAGG - Exonic
990382916 5:55233464-55233486 GTCCCGCCTCCCCGCTCGGGCGG + Exonic
996738186 5:126776642-126776664 GTCCCCGGCCACCGCGGGCGTGG - Intronic
997361900 5:133300487-133300509 GTACCAGGCCACAGCTGGGGAGG - Intronic
999252315 5:150190209-150190231 CTCCCGCGCACCGGCTGGGGCGG - Exonic
1002432189 5:179210105-179210127 GACCCGGGCTACCCCTGGGGTGG - Intronic
1003345265 6:5260913-5260935 GTCCCGCGCCGCTTCGGGGGCGG + Intronic
1005851728 6:29827968-29827990 GTCCTGCGCCCCCGCCGGGCCGG - Intronic
1005859104 6:29887875-29887897 GTCCTGCGCCCCCGCCGGGCGGG - Intergenic
1005926681 6:30451129-30451151 GCCCGGGGCCACCGCTGGGCGGG - Intergenic
1005928416 6:30463848-30463870 GCCCTGGGCCACCGCTGGGCGGG - Intergenic
1006680741 6:35795401-35795423 GGCCCACGGCACCCCTGGGGAGG - Intronic
1014143017 6:117965614-117965636 TTCCCACCCCACAGCTGGGGTGG + Intronic
1015244800 6:131063386-131063408 GTCCCCCGCCCGCGCAGGGGCGG - Intergenic
1023050779 7:36249293-36249315 GCCCCCGGCCACTGCTGGGGAGG + Intronic
1025256242 7:57385549-57385571 GGCCCCCGCCACAGCTGGGGCGG + Intergenic
1029683036 7:102125457-102125479 GTCCCTGGCCGCCGCTGGGAGGG + Intronic
1038010951 8:23475407-23475429 CTCCCACGCCTCCTCTGGGGTGG + Intergenic
1038010963 8:23475468-23475490 CTCCCACGCCTCCTCTGGGGTGG + Intergenic
1040471127 8:47736860-47736882 GTCCTGCGCCACCGGCGGGCGGG + Intergenic
1047248275 8:123162614-123162636 TTCCAGTGCCACCGCCGGGGAGG + Intergenic
1053210004 9:36219631-36219653 GTCCACCACCACCCCTGGGGAGG + Intronic
1057192831 9:93096808-93096830 GTCCCGCGACCTCGCTGGGGTGG - Intronic
1062668856 9:137694418-137694440 GTCCTGCGCCACCGCATGGTGGG - Intronic
1187826160 X:23334686-23334708 GTCCCGCGCCGCGCCTCGGGAGG - Exonic
1190099765 X:47513549-47513571 GGCCCGCGCGGCCGCAGGGGCGG - Intergenic
1192197430 X:69037969-69037991 GTCCCCTGCCACTGCTGGGTGGG - Intergenic
1194571214 X:95556266-95556288 GTCCTGTGCCAATGCTGGGGTGG - Intergenic
1199216314 X:145263516-145263538 GTCCTGTGCCAAGGCTGGGGTGG - Intergenic
1200214205 X:154360263-154360285 GGAGCGGGCCACCGCTGGGGAGG - Exonic
1200279362 X:154763256-154763278 GTCCCACGCCACCGCGGGGTGGG - Intronic