ID: 1117253469 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:53956267-53956289 |
| Sequence | GCCCTTGGTAGGGGGGTCGT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 91 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 5, 4: 85} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1117253469_1117253476 | 17 | Left | 1117253469 | 14:53956267-53956289 | CCAACGACCCCCCTACCAAGGGC | 0: 1 1: 0 2: 0 3: 5 4: 85 |
||
| Right | 1117253476 | 14:53956307-53956329 | TCCTGCCCCGCACTTCCCAAAGG | 0: 1 1: 0 2: 0 3: 10 4: 181 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1117253469 | Original CRISPR | GCCCTTGGTAGGGGGGTCGT TGG (reversed) | Intronic | ||