ID: 1117253469

View in Genome Browser
Species Human (GRCh38)
Location 14:53956267-53956289
Sequence GCCCTTGGTAGGGGGGTCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 85}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117253469_1117253476 17 Left 1117253469 14:53956267-53956289 CCAACGACCCCCCTACCAAGGGC 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1117253476 14:53956307-53956329 TCCTGCCCCGCACTTCCCAAAGG 0: 1
1: 0
2: 0
3: 10
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117253469 Original CRISPR GCCCTTGGTAGGGGGGTCGT TGG (reversed) Intronic