ID: 1117254163

View in Genome Browser
Species Human (GRCh38)
Location 14:53961599-53961621
Sequence CGTGGATGGCAGACAGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117254158_1117254163 29 Left 1117254158 14:53961547-53961569 CCAGTGATATCAGACAGATGAAA No data
Right 1117254163 14:53961599-53961621 CGTGGATGGCAGACAGGGCATGG No data
1117254157_1117254163 30 Left 1117254157 14:53961546-53961568 CCCAGTGATATCAGACAGATGAA No data
Right 1117254163 14:53961599-53961621 CGTGGATGGCAGACAGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117254163 Original CRISPR CGTGGATGGCAGACAGGGCA TGG Intergenic
No off target data available for this crispr