ID: 1117255202

View in Genome Browser
Species Human (GRCh38)
Location 14:53970256-53970278
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117255202_1117255213 25 Left 1117255202 14:53970256-53970278 CCGCGCCCGGCCGACCCATCCTC No data
Right 1117255213 14:53970304-53970326 AGCAAGTCACAGGACTTCTCTGG No data
1117255202_1117255214 26 Left 1117255202 14:53970256-53970278 CCGCGCCCGGCCGACCCATCCTC No data
Right 1117255214 14:53970305-53970327 GCAAGTCACAGGACTTCTCTGGG No data
1117255202_1117255210 15 Left 1117255202 14:53970256-53970278 CCGCGCCCGGCCGACCCATCCTC No data
Right 1117255210 14:53970294-53970316 CCCAGCCTTGAGCAAGTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117255202 Original CRISPR GAGGATGGGTCGGCCGGGCG CGG (reversed) Intergenic