ID: 1117255204

View in Genome Browser
Species Human (GRCh38)
Location 14:53970262-53970284
Sequence GATTAAGAGGATGGGTCGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117255204_1117255214 20 Left 1117255204 14:53970262-53970284 CCGGCCGACCCATCCTCTTAATC No data
Right 1117255214 14:53970305-53970327 GCAAGTCACAGGACTTCTCTGGG No data
1117255204_1117255210 9 Left 1117255204 14:53970262-53970284 CCGGCCGACCCATCCTCTTAATC No data
Right 1117255210 14:53970294-53970316 CCCAGCCTTGAGCAAGTCACAGG No data
1117255204_1117255213 19 Left 1117255204 14:53970262-53970284 CCGGCCGACCCATCCTCTTAATC No data
Right 1117255213 14:53970304-53970326 AGCAAGTCACAGGACTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117255204 Original CRISPR GATTAAGAGGATGGGTCGGC CGG (reversed) Intergenic
No off target data available for this crispr