ID: 1117255207

View in Genome Browser
Species Human (GRCh38)
Location 14:53970271-53970293
Sequence CAGTGCAGTGATTAAGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117255207_1117255214 11 Left 1117255207 14:53970271-53970293 CCATCCTCTTAATCACTGCACTG No data
Right 1117255214 14:53970305-53970327 GCAAGTCACAGGACTTCTCTGGG No data
1117255207_1117255213 10 Left 1117255207 14:53970271-53970293 CCATCCTCTTAATCACTGCACTG No data
Right 1117255213 14:53970304-53970326 AGCAAGTCACAGGACTTCTCTGG No data
1117255207_1117255210 0 Left 1117255207 14:53970271-53970293 CCATCCTCTTAATCACTGCACTG No data
Right 1117255210 14:53970294-53970316 CCCAGCCTTGAGCAAGTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117255207 Original CRISPR CAGTGCAGTGATTAAGAGGA TGG (reversed) Intergenic
No off target data available for this crispr