ID: 1117255214

View in Genome Browser
Species Human (GRCh38)
Location 14:53970305-53970327
Sequence GCAAGTCACAGGACTTCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117255202_1117255214 26 Left 1117255202 14:53970256-53970278 CCGCGCCCGGCCGACCCATCCTC No data
Right 1117255214 14:53970305-53970327 GCAAGTCACAGGACTTCTCTGGG No data
1117255204_1117255214 20 Left 1117255204 14:53970262-53970284 CCGGCCGACCCATCCTCTTAATC No data
Right 1117255214 14:53970305-53970327 GCAAGTCACAGGACTTCTCTGGG No data
1117255206_1117255214 12 Left 1117255206 14:53970270-53970292 CCCATCCTCTTAATCACTGCACT No data
Right 1117255214 14:53970305-53970327 GCAAGTCACAGGACTTCTCTGGG No data
1117255205_1117255214 16 Left 1117255205 14:53970266-53970288 CCGACCCATCCTCTTAATCACTG No data
Right 1117255214 14:53970305-53970327 GCAAGTCACAGGACTTCTCTGGG No data
1117255208_1117255214 7 Left 1117255208 14:53970275-53970297 CCTCTTAATCACTGCACTGCCCA No data
Right 1117255214 14:53970305-53970327 GCAAGTCACAGGACTTCTCTGGG No data
1117255203_1117255214 21 Left 1117255203 14:53970261-53970283 CCCGGCCGACCCATCCTCTTAAT No data
Right 1117255214 14:53970305-53970327 GCAAGTCACAGGACTTCTCTGGG No data
1117255207_1117255214 11 Left 1117255207 14:53970271-53970293 CCATCCTCTTAATCACTGCACTG No data
Right 1117255214 14:53970305-53970327 GCAAGTCACAGGACTTCTCTGGG No data
1117255201_1117255214 29 Left 1117255201 14:53970253-53970275 CCACCGCGCCCGGCCGACCCATC No data
Right 1117255214 14:53970305-53970327 GCAAGTCACAGGACTTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117255214 Original CRISPR GCAAGTCACAGGACTTCTCT GGG Intergenic
No off target data available for this crispr