ID: 1117255365

View in Genome Browser
Species Human (GRCh38)
Location 14:53971696-53971718
Sequence AGTCATAAGCAGAAGATTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117255364_1117255365 -9 Left 1117255364 14:53971682-53971704 CCTTCTGGTCACTGAGTCATAAG No data
Right 1117255365 14:53971696-53971718 AGTCATAAGCAGAAGATTGCTGG No data
1117255357_1117255365 16 Left 1117255357 14:53971657-53971679 CCAGGCACCTTCCACCCTATGAC No data
Right 1117255365 14:53971696-53971718 AGTCATAAGCAGAAGATTGCTGG No data
1117255356_1117255365 17 Left 1117255356 14:53971656-53971678 CCCAGGCACCTTCCACCCTATGA No data
Right 1117255365 14:53971696-53971718 AGTCATAAGCAGAAGATTGCTGG No data
1117255354_1117255365 19 Left 1117255354 14:53971654-53971676 CCCCCAGGCACCTTCCACCCTAT No data
Right 1117255365 14:53971696-53971718 AGTCATAAGCAGAAGATTGCTGG No data
1117255358_1117255365 9 Left 1117255358 14:53971664-53971686 CCTTCCACCCTATGACACCCTTC No data
Right 1117255365 14:53971696-53971718 AGTCATAAGCAGAAGATTGCTGG No data
1117255355_1117255365 18 Left 1117255355 14:53971655-53971677 CCCCAGGCACCTTCCACCCTATG No data
Right 1117255365 14:53971696-53971718 AGTCATAAGCAGAAGATTGCTGG No data
1117255353_1117255365 22 Left 1117255353 14:53971651-53971673 CCTCCCCCAGGCACCTTCCACCC No data
Right 1117255365 14:53971696-53971718 AGTCATAAGCAGAAGATTGCTGG No data
1117255360_1117255365 5 Left 1117255360 14:53971668-53971690 CCACCCTATGACACCCTTCTGGT No data
Right 1117255365 14:53971696-53971718 AGTCATAAGCAGAAGATTGCTGG No data
1117255361_1117255365 2 Left 1117255361 14:53971671-53971693 CCCTATGACACCCTTCTGGTCAC No data
Right 1117255365 14:53971696-53971718 AGTCATAAGCAGAAGATTGCTGG No data
1117255362_1117255365 1 Left 1117255362 14:53971672-53971694 CCTATGACACCCTTCTGGTCACT No data
Right 1117255365 14:53971696-53971718 AGTCATAAGCAGAAGATTGCTGG No data
1117255363_1117255365 -8 Left 1117255363 14:53971681-53971703 CCCTTCTGGTCACTGAGTCATAA No data
Right 1117255365 14:53971696-53971718 AGTCATAAGCAGAAGATTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117255365 Original CRISPR AGTCATAAGCAGAAGATTGC TGG Intergenic
No off target data available for this crispr