ID: 1117255396

View in Genome Browser
Species Human (GRCh38)
Location 14:53971961-53971983
Sequence AAATTAAGAGGTCTGCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117255396_1117255400 -1 Left 1117255396 14:53971961-53971983 CCCTGCAGCAGACCTCTTAATTT No data
Right 1117255400 14:53971983-53972005 TCTTATTATGTGAGAAAAAAGGG No data
1117255396_1117255399 -2 Left 1117255396 14:53971961-53971983 CCCTGCAGCAGACCTCTTAATTT No data
Right 1117255399 14:53971982-53972004 TTCTTATTATGTGAGAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117255396 Original CRISPR AAATTAAGAGGTCTGCTGCA GGG (reversed) Intergenic
No off target data available for this crispr