ID: 1117255399

View in Genome Browser
Species Human (GRCh38)
Location 14:53971982-53972004
Sequence TTCTTATTATGTGAGAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117255394_1117255399 21 Left 1117255394 14:53971938-53971960 CCATCATTGGGTACTTGCACCAG No data
Right 1117255399 14:53971982-53972004 TTCTTATTATGTGAGAAAAAAGG No data
1117255395_1117255399 2 Left 1117255395 14:53971957-53971979 CCAGCCCTGCAGCAGACCTCTTA No data
Right 1117255399 14:53971982-53972004 TTCTTATTATGTGAGAAAAAAGG No data
1117255396_1117255399 -2 Left 1117255396 14:53971961-53971983 CCCTGCAGCAGACCTCTTAATTT No data
Right 1117255399 14:53971982-53972004 TTCTTATTATGTGAGAAAAAAGG No data
1117255397_1117255399 -3 Left 1117255397 14:53971962-53971984 CCTGCAGCAGACCTCTTAATTTC No data
Right 1117255399 14:53971982-53972004 TTCTTATTATGTGAGAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117255399 Original CRISPR TTCTTATTATGTGAGAAAAA AGG Intergenic
No off target data available for this crispr