ID: 1117255463

View in Genome Browser
Species Human (GRCh38)
Location 14:53972739-53972761
Sequence CAAGATAAAGCCTATGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117255461_1117255463 7 Left 1117255461 14:53972709-53972731 CCAGGGAGCAGAACAAATGAGGA No data
Right 1117255463 14:53972739-53972761 CAAGATAAAGCCTATGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117255463 Original CRISPR CAAGATAAAGCCTATGTTGC TGG Intergenic
No off target data available for this crispr