ID: 1117255751

View in Genome Browser
Species Human (GRCh38)
Location 14:53975765-53975787
Sequence TGGGAAGCTTTATGAAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117255751_1117255754 5 Left 1117255751 14:53975765-53975787 CCTCTTTTTCATAAAGCTTCCCA No data
Right 1117255754 14:53975793-53975815 CAGTAGACAATTCAGTTCCAAGG No data
1117255751_1117255756 28 Left 1117255751 14:53975765-53975787 CCTCTTTTTCATAAAGCTTCCCA No data
Right 1117255756 14:53975816-53975838 CAAGTGATGCTGACTGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117255751 Original CRISPR TGGGAAGCTTTATGAAAAAG AGG (reversed) Intergenic
No off target data available for this crispr